{
"title": "pharmcat.example",
"timestamp": "2024-03-26T04:55:27.275Z",
"pharmcatVersion": "v2.10.0",
"cpicVersion": "v1.38.0-1-g39f50e7",
"dpwgVersion": "2024-03-25-16-13",
"genes": {
"CPIC": {
"ABCG2": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "ABCG2",
"chr": "chr4",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "rosuvastatin",
"id": "PA134308647"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "ABCG2",
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "rs2231142 reference (G)/rs2231142 reference (G)",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "ABCG2",
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "rs2231142 reference (G)/rs2231142 reference (G)",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "ABCG2",
"chromosome": "chr4",
"position": 88131171,
"dbSnpId": "rs2231142",
"call": "G/G",
"alleles": [
"rs2231142 variant (T)"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CACNA1S": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "CACNA1S",
"chr": "chr1",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CACNA1S Reference allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "desflurane",
"id": "PA164749136"
},
{
"name": "enflurane",
"id": "PA449461"
},
{
"name": "halothane",
"id": "PA449845"
},
{
"name": "isoflurane",
"id": "PA450106"
},
{
"name": "methoxyflurane",
"id": "PA450434"
},
{
"name": "sevoflurane",
"id": "PA451341"
},
{
"name": "succinylcholine",
"id": "PA451522"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "CACNA1S",
"chromosome": "chr1",
"position": 201060815,
"dbSnpId": "rs1800559",
"call": "C/C",
"alleles": [
"c.3257G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CACNA1S",
"chromosome": "chr1",
"position": 201091993,
"dbSnpId": "rs772226819",
"call": "G/G",
"alleles": [
"c.520C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CFTR": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "CFTR",
"chr": "chr7",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "ivacaftor",
"id": "PA165950341"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"gene": "CFTR",
"phenotypes": [
"ivacaftor non-responsive in CF patients"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"ivacaftor non-responsive in CF patients"
],
"label": "Reference/Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"gene": "CFTR",
"phenotypes": [
"ivacaftor non-responsive in CF patients"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"ivacaftor non-responsive in CF patients"
],
"label": "Reference/Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117509035,
"dbSnpId": "rs397508256",
"call": "G/G",
"alleles": [
"E56K"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117509069,
"dbSnpId": "rs368505753",
"call": "C/C",
"alleles": [
"P67L"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117509089,
"dbSnpId": "rs115545701",
"call": "C/C",
"alleles": [
"R74W"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530953,
"dbSnpId": "rs113993958",
"call": "G/G",
"alleles": [
"D110H"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530955,
"dbSnpId": "rs397508537",
"call": "C/C",
"alleles": [
"D110E"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530974,
"dbSnpId": "rs77834169",
"call": "C/C",
"alleles": [
"R117C"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530975,
"dbSnpId": "rs78655421",
"call": "G/G",
"alleles": [
"R117H"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534318,
"dbSnpId": "rs80282562",
"call": "G/G",
"alleles": [
"G178R"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534363,
"dbSnpId": "rs397508759",
"call": "G/G",
"alleles": [
"E193K"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534368,
"dbSnpId": "rs397508761",
"call": "A/A",
"alleles": [
"711+3A->G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535285,
"dbSnpId": "rs121908752",
"call": "T/T",
"alleles": [
"L206W"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540270,
"dbSnpId": "rs77932196",
"call": "G/G",
"alleles": [
"R347H"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540285,
"dbSnpId": "rs121908753",
"call": "G/G",
"alleles": [
"R352Q"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117548795,
"dbSnpId": "rs74551128",
"call": "C/C",
"alleles": [
"A455E"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587799,
"dbSnpId": "rs121908757",
"call": "A/A",
"alleles": [
"S549R(A>C)"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587800,
"dbSnpId": "rs121908755",
"call": "G/G",
"alleles": [
"S549N"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587801,
"dbSnpId": "rs121909005",
"call": "T/T",
"alleles": [
"S549R(T>G)"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587805,
"dbSnpId": "rs121909013",
"call": "G/G",
"alleles": [
"G551S"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587806,
"dbSnpId": "rs75527207",
"call": "G/G",
"alleles": [
"G551D"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117590409,
"dbSnpId": "rs397508288",
"call": "A/A",
"alleles": [
"D579G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117594930,
"dbSnpId": "rs397508387",
"call": "G/G",
"alleles": [
"E831X"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117602868,
"dbSnpId": "rs80224560",
"call": "G/G",
"alleles": [
"2789+5G->A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603708,
"dbSnpId": "rs397508442",
"call": "C/C",
"alleles": [
"S945L"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117606695,
"dbSnpId": "rs141033578",
"call": "C/C",
"alleles": [
"S977F"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611555,
"dbSnpId": "rs76151804",
"call": "A/A",
"alleles": [
"3272-26A->G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611595,
"dbSnpId": "rs150212784",
"call": "T/T",
"alleles": [
"F1052V"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611620,
"dbSnpId": "rs397508513",
"call": "A/A",
"alleles": [
"K1060T"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611640,
"dbSnpId": "rs121909020",
"call": "G/G",
"alleles": [
"A1067T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611646,
"dbSnpId": "rs200321110",
"call": "G/G",
"alleles": [
"G1069R"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611649,
"dbSnpId": "rs202179988",
"call": "C/C",
"alleles": [
"R1070W"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611650,
"dbSnpId": "rs78769542",
"call": "G/G",
"alleles": [
"R1070Q"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611663,
"dbSnpId": "rs186045772",
"call": "T/T",
"alleles": [
"F1074L"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117614699,
"dbSnpId": "rs75541969",
"call": "G/G",
"alleles": [
"D1152H"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117639961,
"dbSnpId": "rs75039782",
"call": "C/C",
"alleles": [
"3849+10kbC->T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642451,
"dbSnpId": "rs267606723",
"call": "G/G",
"alleles": [
"G1244E"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642472,
"dbSnpId": "rs74503330",
"call": "G/G",
"alleles": [
"S1251N"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642483,
"dbSnpId": "rs121909041",
"call": "T/T",
"alleles": [
"S1255P"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642528,
"dbSnpId": "rs11971167",
"call": "G/G",
"alleles": [
"D1270N"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117664770,
"dbSnpId": "rs193922525",
"call": "G/G",
"alleles": [
"G1349D"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2B6": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "CYP2B6",
"chr": "chr19",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP2B6 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "efavirenz",
"id": "PA449441"
},
{
"name": "sertraline",
"id": "PA451333"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991224,
"dbSnpId": "rs34223104",
"call": "T/T",
"alleles": [
"*22",
"*34",
"*35",
"*36"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991367,
"dbSnpId": "rs34883432",
"call": "A/A",
"alleles": [
"*10"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991369,
"dbSnpId": "rs8192709",
"call": "C/C",
"alleles": [
"*2",
"*10"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991381,
"dbSnpId": "rs33973337",
"call": "A/A",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991388,
"dbSnpId": "rs33980385",
"call": "A/A",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991390,
"dbSnpId": "rs33926104",
"call": "C/C",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991391,
"dbSnpId": "rs34284776",
"call": "G/G",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991441,
"dbSnpId": "rs35303484",
"call": "A/A",
"alleles": [
"*11"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004015,
"dbSnpId": "rs281864907",
"call": "T/T",
"alleles": [
"*38"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004125,
"dbSnpId": "rs36060847",
"call": "G/G",
"alleles": [
"*12"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004133,
"dbSnpId": "rs148009906",
"call": "G/G",
"alleles": [
"*44"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004158,
"dbSnpId": "rs186335453",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004303,
"dbSnpId": "rs139801276",
"call": "T/T",
"alleles": [
"*35"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004377,
"dbSnpId": "rs12721655",
"call": "A/A",
"alleles": [
"*8",
"*13"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004380,
"dbSnpId": "rs535039125",
"call": "C/C",
"alleles": [
"*39"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004381,
"dbSnpId": "rs35773040",
"call": "G/G",
"alleles": [
"*14"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004406,
"dbSnpId": "rs145884402",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006919,
"dbSnpId": "rs3826711",
"call": "C/C",
"alleles": [
"*26"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006923,
"dbSnpId": "rs36056539",
"call": "C/C",
"alleles": [
"*20"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006936,
"dbSnpId": "rs3745274",
"call": "G/G",
"alleles": [
"*6",
"*7",
"*9",
"*13",
"*19",
"*20",
"*26",
"*34",
"*36",
"*37",
"*38",
"*39",
"*40",
"*41",
"*42",
"*43"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006967,
"dbSnpId": "rs58871670",
"call": "G/G",
"alleles": [
"*45"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006968,
"dbSnpId": "rs373489637",
"call": "T/T",
"alleles": [
"*37"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41007013,
"dbSnpId": "rs36079186",
"call": "T/T",
"alleles": [
"*27",
"*35"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41009313,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*46"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41009350,
"dbSnpId": "rs45482602",
"call": "C/C",
"alleles": [
"*3"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41009358,
"dbSnpId": "rs2279343",
"call": "A/A",
"alleles": [
"*4",
"*6",
"*7",
"*13",
"*18",
"*19",
"*20",
"*26",
"*34",
"*36",
"*37",
"*38",
"*39",
"*40",
"*41",
"*42",
"*43"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41010006,
"dbSnpId": "rs139029625",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41010088,
"dbSnpId": "rs34698757",
"call": "C/C",
"alleles": [
"*28"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41010108,
"dbSnpId": "rs193922917",
"call": "C/C",
"alleles": [
"*31"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012316,
"dbSnpId": "rs28399499",
"call": "T/T",
"alleles": [
"*18"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012339,
"dbSnpId": "rs34826503",
"call": "C/C",
"alleles": [
"*19"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012393,
"dbSnpId": "rs754621576",
"call": "T/T",
"alleles": [
"*47"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012394,
"dbSnpId": "rs780991919",
"call": "A/A",
"alleles": [
"*47"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012465,
"dbSnpId": "rs34097093",
"call": "C/C",
"alleles": [
"*28"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012466,
"dbSnpId": "rs200458614",
"call": "G/G",
"alleles": [
"*40"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012471,
"dbSnpId": "rs201500445",
"call": "T/T",
"alleles": [
"*41"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012478,
"dbSnpId": "rs200238771",
"call": "T/T",
"alleles": [
"*48"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012693,
"dbSnpId": "rs35979566",
"call": "T/T",
"alleles": [
"*15"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012740,
"dbSnpId": "rs193922918",
"call": "G/G",
"alleles": [
"*32"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012803,
"dbSnpId": "rs35010098",
"call": "C/C",
"alleles": [
"*21"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016652,
"dbSnpId": "rs764288403",
"call": "G/G",
"alleles": [
"*49"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016679,
"dbSnpId": "rs374099483",
"call": "G/G",
"alleles": [
"*42"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016726,
"dbSnpId": "rs3211369",
"call": "A/A",
"alleles": [
"*23"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016741,
"dbSnpId": "rs117872433",
"call": "G/G",
"alleles": [
"*43"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016778,
"dbSnpId": "rs564083989",
"call": "G/G",
"alleles": [
"*24"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016805,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*25"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016810,
"dbSnpId": "rs3211371",
"call": "C/C",
"alleles": [
"*5",
"*7",
"*33",
"*34"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2C19": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "CYP2C19",
"chr": "chr10",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP2C19 *38 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "amitriptyline",
"id": "PA448385"
},
{
"name": "citalopram",
"id": "PA449015"
},
{
"name": "clomipramine",
"id": "PA449048"
},
{
"name": "clopidogrel",
"id": "PA449053"
},
{
"name": "dexlansoprazole",
"id": "PA166110257"
},
{
"name": "doxepin",
"id": "PA449409"
},
{
"name": "escitalopram",
"id": "PA10074"
},
{
"name": "imipramine",
"id": "PA449969"
},
{
"name": "lansoprazole",
"id": "PA450180"
},
{
"name": "omeprazole",
"id": "PA450704"
},
{
"name": "pantoprazole",
"id": "PA450774"
},
{
"name": "sertraline",
"id": "PA451333"
},
{
"name": "trimipramine",
"id": "PA451791"
},
{
"name": "voriconazole",
"id": "PA10233"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94761900,
"dbSnpId": "rs12248560",
"call": "C/C",
"alleles": [
"*1",
"*4",
"*17"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762706,
"dbSnpId": "rs28399504",
"call": "A/A",
"alleles": [
"*1",
"*4"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762712,
"dbSnpId": "rs367543002",
"call": "C/C",
"alleles": [
"*1",
"*34"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762715,
"dbSnpId": "rs367543003",
"call": "T/T",
"alleles": [
"*1",
"*34"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762755,
"dbSnpId": "rs55752064",
"call": "T/T",
"alleles": [
"*1",
"*14"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762760,
"dbSnpId": "rs17882687",
"call": "A/A",
"alleles": [
"*1",
"*15",
"*28",
"*35",
"*39"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762788,
"dbSnpId": "rs1564656981",
"call": "A/A",
"alleles": [
"*1",
"*29"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762856,
"dbSnpId": "rs1564657013",
"call": "A/A",
"alleles": [
"*1",
"*19"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775106,
"dbSnpId": "rs145328984",
"call": "C/C",
"alleles": [
"*1",
"*30"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775121,
"dbSnpId": "rs1564660997",
"call": "C/C",
"alleles": [
"*1",
"*31"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775160,
"dbSnpId": "rs118203756",
"call": "G/G",
"alleles": [
"*1",
"*23"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775185,
"dbSnpId": "rs1288601658",
"call": "A/A",
"alleles": [
"*1",
"*32"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775367,
"dbSnpId": "rs12769205",
"call": "A/A",
"alleles": [
"*1",
"*2",
"*35"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775416,
"dbSnpId": "rs41291556",
"call": "T/T",
"alleles": [
"*1",
"*8"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775423,
"dbSnpId": "rs17885179",
"call": "A/A",
"alleles": [
"*1",
"*39"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775453,
"dbSnpId": "rs72552267",
"call": "G/G",
"alleles": [
"*1",
"*6"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775489,
"dbSnpId": "rs17884712",
"call": "G/G",
"alleles": [
"*1",
"*9"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775507,
"dbSnpId": "rs58973490",
"call": "G/G",
"alleles": [
"*1",
"*2",
"*11"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780574,
"dbSnpId": "rs140278421",
"call": "G/G",
"alleles": [
"*1",
"*22"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780579,
"dbSnpId": "rs370803989",
"call": "G/G",
"alleles": [
"*1",
"*33"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780653,
"dbSnpId": "rs4986893",
"call": "G/G",
"alleles": [
"*1",
"*3"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781858,
"dbSnpId": "rs6413438",
"call": "C/C",
"alleles": [
"*1",
"*10"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781859,
"dbSnpId": "rs4244285",
"call": "G/G",
"alleles": [
"*1",
"*2"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781944,
"dbSnpId": "rs375781227",
"call": "G/G",
"alleles": [
"*1",
"*26"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781999,
"dbSnpId": "rs72558186",
"call": "T/T",
"alleles": [
"*1",
"*7"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842861,
"dbSnpId": "rs138142612",
"call": "G/G",
"alleles": [
"*1",
"*18"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842866,
"dbSnpId": "rs3758581",
"call": "A/A",
"alleles": [
"*1",
"*2",
"*3",
"*4",
"*5",
"*6",
"*7",
"*8",
"*9",
"*10",
"*11",
"*12",
"*13",
"*14",
"*15",
"*17",
"*18",
"*19",
"*22",
"*23",
"*24",
"*25",
"*26",
"*28",
"*29",
"*31",
"*32",
"*33",
"*35",
"*39"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842879,
"dbSnpId": "rs118203757",
"call": "G/G",
"alleles": [
"*1",
"*24"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842995,
"dbSnpId": "rs113934938",
"call": "G/G",
"alleles": [
"*1",
"*28"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94849995,
"dbSnpId": "rs17879685",
"call": "C/C",
"alleles": [
"*1",
"*13"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852738,
"dbSnpId": "rs56337013",
"call": "C/C",
"alleles": [
"*1",
"*5"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852765,
"dbSnpId": "rs192154563",
"call": "C/C",
"alleles": [
"*1",
"*16"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852785,
"dbSnpId": "rs118203759",
"call": "C/C",
"alleles": [
"*1",
"*25"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852914,
"dbSnpId": "rs55640102",
"call": "A/A",
"alleles": [
"*1",
"*12"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2C9": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "CYP2C9",
"chr": "chr10",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP2C9 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "celecoxib",
"id": "PA448871"
},
{
"name": "flurbiprofen",
"id": "PA449683"
},
{
"name": "fluvastatin",
"id": "PA449688"
},
{
"name": "fosphenytoin",
"id": "PA164746820"
},
{
"name": "ibuprofen",
"id": "PA449957"
},
{
"name": "lornoxicam",
"id": "PA165958395"
},
{
"name": "meloxicam",
"id": "PA450353"
},
{
"name": "phenytoin",
"id": "PA450947"
},
{
"name": "piroxicam",
"id": "PA450985"
},
{
"name": "tenoxicam",
"id": "PA131890625"
},
{
"name": "warfarin",
"id": "PA451906"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938683,
"dbSnpId": "rs114071557",
"call": "A/A",
"alleles": [
"*36"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938719,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*80"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938737,
"dbSnpId": "rs67807361",
"call": "C/C",
"alleles": [
"*7"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938771,
"dbSnpId": "rs142240658",
"call": "C/C",
"alleles": [
"*21"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938788,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*83"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938800,
"dbSnpId": "rs1364419386",
"call": "G/G",
"alleles": [
"*76"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938803,
"dbSnpId": "rs2031308986",
"call": "A/A",
"alleles": [
"*22"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938828,
"dbSnpId": "rs564813580",
"call": "A/A",
"alleles": [
"*37"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941897,
"dbSnpId": "rs371055887",
"call": "G/G",
"alleles": [
"*20"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941915,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941958,
"dbSnpId": "rs72558187",
"call": "T/T",
"alleles": [
"*13"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941975,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*77"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941976,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*38"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941982,
"dbSnpId": "rs762239445",
"call": "G/G",
"alleles": [
"*39"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942018,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*40"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942205,
"dbSnpId": "rs1304490498",
"call": "CAATGGAAAGA/CAATGGAAAGA",
"alleles": [
"*25"
],
"phased": false,
"wildtypeAllele": "CAATGGAAAGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942216,
"dbSnpId": "rs774607211",
"call": "A/A",
"alleles": [
"*41"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942230,
"dbSnpId": "rs767576260",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942231,
"dbSnpId": "rs12414460",
"call": "G/G",
"alleles": [
"*42"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942233,
"dbSnpId": "rs375805362",
"call": "C/C",
"alleles": [
"*62"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942234,
"dbSnpId": "rs72558189",
"call": "G/G",
"alleles": [
"*14",
"*35"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942243,
"dbSnpId": "rs1375956433",
"call": "T/T",
"alleles": [
"*78"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942249,
"dbSnpId": "rs200965026",
"call": "C/C",
"alleles": [
"*26",
"*44"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942254,
"dbSnpId": "rs199523631",
"call": "C/C",
"alleles": [
"*45"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942255,
"dbSnpId": "rs200183364",
"call": "G/G",
"alleles": [
"*33"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942290,
"dbSnpId": "rs1799853",
"call": "C/C",
"alleles": [
"*2",
"*35",
"*61"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942291,
"dbSnpId": "rs141489852",
"call": "G/G",
"alleles": [
"*63"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942305,
"dbSnpId": "rs754487195",
"call": "G/G",
"alleles": [
"*46"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942306,
"dbSnpId": "rs1289704600",
"call": "C/C",
"alleles": [
"*72"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942308,
"dbSnpId": "rs17847037",
"call": "C/C",
"alleles": [
"*73"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942309,
"dbSnpId": "rs7900194",
"call": "G/G",
"alleles": [
"*8",
"*27"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947782,
"dbSnpId": "rs72558190",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947785,
"dbSnpId": "rs774550549",
"call": "C/C",
"alleles": [
"*47"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947869,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*69"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947907,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*57"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947917,
"dbSnpId": "rs1326630788",
"call": "T/T",
"alleles": [
"*48"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947938,
"dbSnpId": "rs2031531005",
"call": "A/A",
"alleles": [
"*28"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947939,
"dbSnpId": "rs370100007",
"call": "G/G",
"alleles": [
"*74"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949129,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*49"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949144,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*50"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949145,
"dbSnpId": "rs772782449",
"call": "C/C",
"alleles": [
"*82"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949161,
"dbSnpId": null,
"call": "AT/AT",
"alleles": [
"*85"
],
"phased": false,
"wildtypeAllele": "AT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949217,
"dbSnpId": "rs2256871",
"call": "A/A",
"alleles": [
"*9"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949280,
"dbSnpId": "rs9332130",
"call": "A/A",
"alleles": [
"*10",
"*71"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949281,
"dbSnpId": "rs9332131",
"call": "GA/GA",
"alleles": [
"*6"
],
"phased": false,
"wildtypeAllele": "GA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972119,
"dbSnpId": "rs182132442",
"call": "C/C",
"alleles": [
"*29"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972123,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*64"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972134,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*51"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972179,
"dbSnpId": "rs72558192",
"call": "A/A",
"alleles": [
"*16"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972180,
"dbSnpId": "rs988617574",
"call": "C/C",
"alleles": [
"*52"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972183,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*81"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972233,
"dbSnpId": "rs1237225311",
"call": "C/C",
"alleles": [
"*53"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981199,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*65"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981201,
"dbSnpId": "rs57505750",
"call": "T/T",
"alleles": [
"*31"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981224,
"dbSnpId": "rs28371685",
"call": "C/C",
"alleles": [
"*11"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981225,
"dbSnpId": "rs367826293",
"call": "G/G",
"alleles": [
"*34"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981230,
"dbSnpId": "rs1274535931",
"call": "C/C",
"alleles": [
"*58"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981250,
"dbSnpId": "rs750820937",
"call": "C/C",
"alleles": [
"*54"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981258,
"dbSnpId": "rs1297714792",
"call": "C/C",
"alleles": [
"*79"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981281,
"dbSnpId": "rs749060448",
"call": "G/G",
"alleles": [
"*24"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981296,
"dbSnpId": "rs1057910",
"call": "A/A",
"alleles": [
"*3",
"*18",
"*68"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981297,
"dbSnpId": "rs56165452",
"call": "T/T",
"alleles": [
"*4"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981301,
"dbSnpId": "rs28371686",
"call": "C/C",
"alleles": [
"*5"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981302,
"dbSnpId": "rs1250577724",
"call": "C/C",
"alleles": [
"*55"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981305,
"dbSnpId": "rs578144976",
"call": "C/C",
"alleles": [
"*66"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981365,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981371,
"dbSnpId": "rs542577750",
"call": "G/G",
"alleles": [
"*68"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986042,
"dbSnpId": "rs764211126",
"call": "A/A",
"alleles": [
"*56"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986073,
"dbSnpId": "rs72558193",
"call": "A/A",
"alleles": [
"*18"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986136,
"dbSnpId": "rs1254213342",
"call": "A/A",
"alleles": [
"*75"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986174,
"dbSnpId": "rs1441296358",
"call": "G/G",
"alleles": [
"*84"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988852,
"dbSnpId": "rs776908257",
"call": "C/C",
"alleles": [
"*67"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988855,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*59"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988880,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*70"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988917,
"dbSnpId": "rs769942899",
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988925,
"dbSnpId": "rs202201137",
"call": "A/A",
"alleles": [
"*61"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988955,
"dbSnpId": "rs767284820",
"call": "T/T",
"alleles": [
"*60"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988984,
"dbSnpId": "rs781583846",
"call": "G/G",
"alleles": [
"*30"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94989020,
"dbSnpId": "rs9332239",
"call": "C/C",
"alleles": [
"*12",
"*71"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94989023,
"dbSnpId": "rs868182778",
"call": "G/G",
"alleles": [
"*32"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94645745,
"dbSnpId": "rs12777823",
"call": "G/G",
"alleles": [],
"phased": false,
"wildtypeAllele": null,
"hasUndocumentedVariations": false,
"warnings": []
}
],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2D6": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "CYP2D6",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "OUTSIDE",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "pcat-outside-call",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "",
"message": "This comes from an outside data source which does not supply position-level detail. For specific disclaimers and limitations, see the original genotyping source."
}
],
"relatedDrugs": [
{
"name": "amitriptyline",
"id": "PA448385"
},
{
"name": "atomoxetine",
"id": "PA134688071"
},
{
"name": "clomipramine",
"id": "PA449048"
},
{
"name": "codeine",
"id": "PA449088"
},
{
"name": "desipramine",
"id": "PA449233"
},
{
"name": "doxepin",
"id": "PA449409"
},
{
"name": "fluvoxamine",
"id": "PA449690"
},
{
"name": "hydrocodone",
"id": "PA449900"
},
{
"name": "imipramine",
"id": "PA449969"
},
{
"name": "nortriptyline",
"id": "PA450657"
},
{
"name": "ondansetron",
"id": "PA450705"
},
{
"name": "paroxetine",
"id": "PA450801"
},
{
"name": "tamoxifen",
"id": "PA451581"
},
{
"name": "tramadol",
"id": "PA451735"
},
{
"name": "trimipramine",
"id": "PA451791"
},
{
"name": "tropisetron",
"id": "PA161925594"
},
{
"name": "venlafaxine",
"id": "PA451866"
},
{
"name": "vortioxetine",
"id": "PA166122595"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP3A5": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "CYP3A5",
"chr": "chr7",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "CYP3A5 reverse complement footnote",
"version": "1",
"matches": {
"gene": "CYP3A5",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The CYP3A5 gene is on the negative chromosomal strand, all genotype calls for CYP3A5 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP3A5 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "tacrolimus",
"id": "PA451578"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99652770,
"dbSnpId": "rs41303343",
"call": "T/T",
"alleles": [
"*7"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99660516,
"dbSnpId": "rs28383479",
"call": "C/C",
"alleles": [
"*9"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99665212,
"dbSnpId": "rs10264272",
"call": "C/C",
"alleles": [
"*6"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99672916,
"dbSnpId": "rs776746",
"call": "T/T",
"alleles": [
"*3"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99676198,
"dbSnpId": "rs55817950",
"call": "G/G",
"alleles": [
"*8"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP4F2": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": null,
"phenotypeSource": "CPIC",
"geneSymbol": "CYP4F2",
"chr": "chr19",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP4F2 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "warfarin",
"id": "PA451906"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"allele2": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"gene": "CYP4F2",
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"allele2": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"gene": "CYP4F2",
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15878779,
"dbSnpId": "rs3093200",
"call": "G/G",
"alleles": [
"*5"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15878920,
"dbSnpId": "rs4020346",
"call": "T/T",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15879412,
"dbSnpId": "rs138971789",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15879621,
"dbSnpId": "rs2108622",
"call": "C/C",
"alleles": [
"*3",
"*4"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15886018,
"dbSnpId": "rs145174239",
"call": "G/G",
"alleles": [
"*14"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15889671,
"dbSnpId": "rs144233412",
"call": "C/C",
"alleles": [
"*13"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15890405,
"dbSnpId": "rs3093153",
"call": "C/C",
"alleles": [
"*6"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15892541,
"dbSnpId": "rs145875499",
"call": "C/C",
"alleles": [
"*12"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15895527,
"dbSnpId": "rs114396708",
"call": "G/G",
"alleles": [
"*11"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15895560,
"dbSnpId": "rs144455532",
"call": "G/G",
"alleles": [
"*10"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15897466,
"dbSnpId": "rs201380574",
"call": "C/C",
"alleles": [
"*9"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15897473,
"dbSnpId": "rs115517770",
"call": "G/G",
"alleles": [
"*8"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15897566,
"dbSnpId": "rs114099324",
"call": "C/C",
"alleles": [
"*7"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15897578,
"dbSnpId": "rs3093105",
"call": "A/A",
"alleles": [
"*2",
"*4"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"DPYD": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "DPYD",
"chr": "chr1",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "DPYD lowest activity score note",
"version": "2",
"matches": {
"gene": "DPYD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": [
"capecitabine",
"fluorouracil",
"tegafur",
"flucytosine"
]
},
"exception_type": "note",
"message": "The two lowest activity values (variant activity scores, see CPIC guideline PMID:29152729) are used for unphased data and the lowest activity value per allele is used for phased data to determine the gene activity score and phenotype to retrieve prescribing recommendations. "
},
{
"rule_name": "DPYD reverse complement footnote",
"version": "1",
"matches": {
"gene": "DPYD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The DPYD gene is on the negative chromosomal strand, all genotype calls for DPYD in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The DPYD Reference allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "capecitabine",
"id": "PA448771"
},
{
"name": "fluorouracil",
"id": "PA128406956"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": null,
"gene": "DPYD",
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "n/a",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97078987,
"dbSnpId": "rs114096998",
"call": "G/G",
"alleles": [
"c.3067C>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97078993,
"dbSnpId": "rs148799944",
"call": "C/C",
"alleles": [
"c.3061G>C"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079005,
"dbSnpId": "rs140114515",
"call": "C/C",
"alleles": [
"c.3049G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079071,
"dbSnpId": "rs1801268",
"call": "C/C",
"alleles": [
"c.2983G>T (*10)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079076,
"dbSnpId": "rs139459586",
"call": "A/A",
"alleles": [
"c.2978T>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079077,
"dbSnpId": "rs202144771",
"call": "G/G",
"alleles": [
"c.2977C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079121,
"dbSnpId": "rs72547601",
"call": "T/T",
"alleles": [
"c.2933A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079133,
"dbSnpId": "rs72547602",
"call": "T/T",
"alleles": [
"c.2921A>T"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079139,
"dbSnpId": "rs145529148",
"call": "T/T",
"alleles": [
"c.2915A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97082365,
"dbSnpId": "rs141044036",
"call": "T/T",
"alleles": [
"c.2872A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97082391,
"dbSnpId": "rs67376798",
"call": "T/T",
"alleles": [
"c.2846A>T"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098598,
"dbSnpId": "rs1801267",
"call": "C/C",
"alleles": [
"c.2657G>A (*9B)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098599,
"dbSnpId": "rs147545709",
"call": "G/G",
"alleles": [
"c.2656C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098616,
"dbSnpId": "rs55674432",
"call": "C/C",
"alleles": [
"c.2639G>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098632,
"dbSnpId": "rs201035051",
"call": "T/T",
"alleles": [
"c.2623A>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97193109,
"dbSnpId": "rs60139309",
"call": "T/T",
"alleles": [
"c.2582A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97193209,
"dbSnpId": "rs200687447",
"call": "C/C",
"alleles": [
"c.2482G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97234958,
"dbSnpId": "rs199634007",
"call": "G/G",
"alleles": [
"c.2336C>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97234991,
"dbSnpId": "rs56005131",
"call": "G/G",
"alleles": [
"c.2303C>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305279,
"dbSnpId": "rs112766203",
"call": "G/G",
"alleles": [
"c.2279C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305363,
"dbSnpId": "rs60511679",
"call": "A/A",
"alleles": [
"c.2195T>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305364,
"dbSnpId": "rs1801160",
"call": "C/C",
"alleles": [
"c.2194G>A (*6)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305372,
"dbSnpId": "rs146529561",
"call": "G/G",
"alleles": [
"c.2186C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97306195,
"dbSnpId": "rs145548112",
"call": "C/C",
"alleles": [
"c.2161G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97373598,
"dbSnpId": "rs137999090",
"call": "C/C",
"alleles": [
"c.2021G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97373629,
"dbSnpId": "rs138545885",
"call": "C/C",
"alleles": [
"c.1990G>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97382461,
"dbSnpId": "rs55971861",
"call": "T/T",
"alleles": [
"c.1906A>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450058,
"dbSnpId": "rs3918290",
"call": "C/C",
"alleles": [
"c.1905+1G>A (*2A)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450059,
"dbSnpId": "rs3918289",
"call": "G/G",
"alleles": [
"c.1905C>G"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450065,
"dbSnpId": "rs72549303",
"call": "TG/TG",
"alleles": [
"c.1898delC (*3)"
],
"phased": false,
"wildtypeAllele": "TG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450068,
"dbSnpId": "rs17376848",
"call": "A/A",
"alleles": [
"c.1896T>C"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450168,
"dbSnpId": "rs147601618",
"call": "A/A",
"alleles": [
"c.1796T>C"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450187,
"dbSnpId": "rs145773863",
"call": "C/C",
"alleles": [
"c.1777G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450189,
"dbSnpId": "rs138616379",
"call": "C/C",
"alleles": [
"c.1775G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450190,
"dbSnpId": "rs59086055",
"call": "G/G",
"alleles": [
"c.1774C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515784,
"dbSnpId": "rs201615754",
"call": "C/C",
"alleles": [
"c.1682G>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515787,
"dbSnpId": "rs55886062",
"call": "A/A",
"alleles": [
"c.1679T>G (*13)"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515839,
"dbSnpId": "rs1801159",
"call": "T/T",
"alleles": [
"c.1627A>G (*5)"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515851,
"dbSnpId": "rs142619737",
"call": "C/C",
"alleles": [
"c.1615G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515865,
"dbSnpId": "rs1801158",
"call": "C/C",
"alleles": [
"c.1601G>A (*4)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515889,
"dbSnpId": "rs190951787",
"call": "G/G",
"alleles": [
"c.1577C>G"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515923,
"dbSnpId": "rs148994843",
"call": "C/C",
"alleles": [
"c.1543G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549565,
"dbSnpId": "rs138391898",
"call": "C/C",
"alleles": [
"c.1519G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549600,
"dbSnpId": "rs111858276",
"call": "T/T",
"alleles": [
"c.1484A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549609,
"dbSnpId": "rs72549304",
"call": "G/G",
"alleles": [
"c.1475C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549681,
"dbSnpId": "rs199549923",
"call": "G/G",
"alleles": [
"c.1403C>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549713,
"dbSnpId": "rs57918000",
"call": "G/G",
"alleles": [
"c.1371C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549726,
"dbSnpId": "rs144395748",
"call": "G/G",
"alleles": [
"c.1358C>G"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549735,
"dbSnpId": "rs72975710",
"call": "G/G",
"alleles": [
"c.1349C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573785,
"dbSnpId": "rs186169810",
"call": "A/A",
"alleles": [
"c.1314T>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573805,
"dbSnpId": "rs142512579",
"call": "C/C",
"alleles": [
"c.1294G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573821,
"dbSnpId": "rs764666241",
"call": "C/C",
"alleles": [
"c.1278G>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573839,
"dbSnpId": "rs200064537",
"call": "A/A",
"alleles": [
"c.1260T>A"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573863,
"dbSnpId": "rs56038477",
"call": "C/C",
"alleles": [
"c.1129-5923C>G, c.1236G>A (HapB3)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573881,
"dbSnpId": "rs61622928",
"call": "C/C",
"alleles": [
"c.1218G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573918,
"dbSnpId": "rs143815742",
"call": "C/C",
"alleles": [
"c.1181G>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573919,
"dbSnpId": "rs140602333",
"call": "G/G",
"alleles": [
"c.1180C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573943,
"dbSnpId": "rs78060119",
"call": "C/C",
"alleles": [
"c.1156G>T (*12)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97579893,
"dbSnpId": "rs75017182",
"call": "G/G",
"alleles": [
"c.1129-5923C>G",
"c.1129-5923C>G, c.1236G>A (HapB3)"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593238,
"dbSnpId": "rs72549305",
"call": "T/T",
"alleles": [
"c.1108A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593289,
"dbSnpId": "rs143154602",
"call": "G/G",
"alleles": [
"c.1057C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593322,
"dbSnpId": "rs183385770",
"call": "C/C",
"alleles": [
"c.1024G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593343,
"dbSnpId": "rs72549306",
"call": "C/C",
"alleles": [
"c.1003G>T (*11)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593379,
"dbSnpId": "rs201018345",
"call": "C/C",
"alleles": [
"c.967G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97595083,
"dbSnpId": "rs145112791",
"call": "G/G",
"alleles": [
"c.934C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97595088,
"dbSnpId": "rs150437414",
"call": "A/A",
"alleles": [
"c.929T>C"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97595149,
"dbSnpId": "rs146356975",
"call": "T/T",
"alleles": [
"c.868A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97679170,
"dbSnpId": "rs45589337",
"call": "T/T",
"alleles": [
"c.775A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97691776,
"dbSnpId": "rs1801266",
"call": "G/G",
"alleles": [
"c.703C>T (*8)"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699399,
"dbSnpId": "rs72549307",
"call": "T/T",
"alleles": [
"c.632A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699430,
"dbSnpId": "rs72549308",
"call": "T/T",
"alleles": [
"c.601A>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699474,
"dbSnpId": "rs115232898",
"call": "T/T",
"alleles": [
"c.557A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699506,
"dbSnpId": "rs6670886",
"call": "C/C",
"alleles": [
"c.525G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699533,
"dbSnpId": "rs139834141",
"call": "C/C",
"alleles": [
"c.498G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699535,
"dbSnpId": "rs2297595",
"call": "T/T",
"alleles": [
"c.496A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97721542,
"dbSnpId": "rs200562975",
"call": "T/T",
"alleles": [
"c.451A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97721650,
"dbSnpId": "rs141462178",
"call": "T/T",
"alleles": [
"c.343A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97740400,
"dbSnpId": "rs150385342",
"call": "C/C",
"alleles": [
"c.313G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97740410,
"dbSnpId": "rs72549309",
"call": "GATGA/GATGA",
"alleles": [
"c.295_298delTCAT (*7)"
],
"phased": false,
"wildtypeAllele": "GATGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883329,
"dbSnpId": "rs1801265",
"call": "A/A",
"alleles": [
"c.85T>C (*9A)"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883352,
"dbSnpId": "rs80081766",
"call": "C/C",
"alleles": [
"c.62G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883353,
"dbSnpId": "rs72549310",
"call": "G/G",
"alleles": [
"c.61C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883368,
"dbSnpId": "rs150036960",
"call": "G/G",
"alleles": [
"c.46C>G"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"G6PD": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "G6PD",
"chr": "chrX",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The G6PD B (reference) allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "dapsone",
"id": "PA449211"
},
{
"name": "methylene blue",
"id": "PA450457"
},
{
"name": "nitrofurantoin",
"id": "PA450640"
},
{
"name": "pegloticase",
"id": "PA165963961"
},
{
"name": "primaquine",
"id": "PA451103"
},
{
"name": "rasburicase",
"id": "PA10176"
},
{
"name": "tafenoquine",
"id": "PA166115580"
},
{
"name": "toluidine blue",
"id": "PA166268821"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532046,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Bangkok Noi"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532055,
"dbSnpId": null,
"call": "CTCT/CTCT",
"alleles": [
"Brighton"
],
"phased": false,
"wildtypeAllele": "CTCT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532082,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Arakawa"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532083,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Buenos Aires"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532085,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Campinas"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532086,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Fukaya"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532203,
"dbSnpId": "rs137852348",
"call": "G/G",
"alleles": [
"Split"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532231,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Laibin"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532245,
"dbSnpId": "rs137852344",
"call": "G/G",
"alleles": [
"Neapolis"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532257,
"dbSnpId": "rs72554664",
"call": "C/C",
"alleles": [
"Kaiping, Anant, Dhon, Sapporo-like, Wosera"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532258,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Flores",
"Kamiube, Keelung"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532264,
"dbSnpId": "rs782608284",
"call": "C/C",
"alleles": [
"Yunan"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532265,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Nice"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532269,
"dbSnpId": "rs72554665",
"call": "C/C",
"alleles": [
"Bangkok Noi",
"Canton, Taiwan-Hakka, Gifu-like, Agrigento-like",
"Cosenza"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532278,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Amiens"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532279,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Figuera da Foz"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532389,
"dbSnpId": "rs137852324",
"call": "C/C",
"alleles": [
"Andalus"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532390,
"dbSnpId": "rs398123546",
"call": "G/G",
"alleles": [
"Hermoupolis",
"Honiara",
"Union,Maewo, Chinese-2, Kalo"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532392,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Harima"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532403,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Cassano",
"Hermoupolis"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532408,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"S. Antioco"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532411,
"dbSnpId": "rs137852317",
"call": "C/C",
"alleles": [
"Santiago de Cuba, Morioka"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532432,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Telti, Kobe"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532434,
"dbSnpId": "rs137852337",
"call": "C/C",
"alleles": [
"Pawnee"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532458,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Sumare"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532459,
"dbSnpId": "rs782098548",
"call": "C/C",
"alleles": [
"Surabaya"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532570,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Georgia"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532590,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"202G>A_376A>G_1264C>G"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532608,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Tokyo, Fukushima"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532623,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Munich"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532625,
"dbSnpId": "rs137852336",
"call": "C/C",
"alleles": [
"Japan, Shinagawa",
"Kawasaki"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532626,
"dbSnpId": "rs137852323",
"call": "C/C",
"alleles": [
"Riverside"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532628,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Suwalki"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532629,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Utrecht"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532634,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Abeno"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532639,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Clinic"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532649,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Covao do Lobo"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532661,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Anadia"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532662,
"dbSnpId": "rs137852325",
"call": "C/C",
"alleles": [
"Puerto Limon"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532667,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Bari"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532674,
"dbSnpId": "rs137852335",
"call": "C/C",
"alleles": [
"Alhambra"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532676,
"dbSnpId": "rs137852316",
"call": "C/C",
"alleles": [
"Nashville, Anaheim, Portici"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532677,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Wisconsin"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532679,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Krakow"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532688,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Praha"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532692,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Hartford"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532694,
"dbSnpId": "rs137852321",
"call": "C/C",
"alleles": [
"Beverly Hills, Genova, Iwate, Niigata, Yamaguchi"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532695,
"dbSnpId": "rs137852334",
"call": "G/G",
"alleles": [
"Guadalajara",
"Mt Sinai"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532698,
"dbSnpId": "rs137852320",
"call": "T/T",
"alleles": [
"Iowa, Walter Reed, Springfield"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532699,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Madrid"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532700,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Lynwood"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532701,
"dbSnpId": "rs137852322",
"call": "A/A",
"alleles": [
"Tomah"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532713,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Olomouc"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532715,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Riley"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532716,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Calvo Mackenna"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532722,
"dbSnpId": "rs371489738",
"call": "C/C",
"alleles": [
"Montpellier"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532752,
"dbSnpId": null,
"call": "CGGCCTTGCGCTCGTTCAG/CGGCCTTGCGCTCGTTCAG",
"alleles": [
"Tondela"
],
"phased": false,
"wildtypeAllele": "CGGCCTTGCGCTCGTTCAG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532758,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Tenri"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532765,
"dbSnpId": "rs137852329",
"call": "G/G",
"alleles": [
"Aachen",
"Loma Linda"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532772,
"dbSnpId": "rs137852345",
"call": "G/G",
"alleles": [
"Serres"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532773,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Iwatsuki"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532797,
"dbSnpId": "rs137852333",
"call": "G/G",
"alleles": [
"Ierapetra"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532802,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Partenope"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532945,
"dbSnpId": "rs34193178",
"call": "C/C",
"alleles": [
"Mira d'Aire"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532956,
"dbSnpId": "rs398123544",
"call": "T/T",
"alleles": [
"Cincinnati"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532969,
"dbSnpId": "rs137852342",
"call": "G/G",
"alleles": [
"Chinese-5"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532987,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Torun"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532989,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Fushan"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532990,
"dbSnpId": "rs5030869",
"call": "C/C",
"alleles": [
"Chatham"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533004,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Insuli"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533012,
"dbSnpId": null,
"call": "CGTGGGGTCGTCCAGGTACCCTTTG/CGTGGGGTCGTCCAGGTACCCTTTG",
"alleles": [
"Nara"
],
"phased": false,
"wildtypeAllele": "CGTGGGGTCGTCCAGGTACCCTTTG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533016,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Farroupilha"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533025,
"dbSnpId": "rs76723693",
"call": "A/A",
"alleles": [
"A- 968C_376G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533029,
"dbSnpId": "rs137852347",
"call": "A/A",
"alleles": [
"Rehevot"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533031,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Manhattan"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533044,
"dbSnpId": "rs137852339",
"call": "C/C",
"alleles": [
"Kalyan-Kerala, Jamnaga, Rohini"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533064,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Ludhiana"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533072,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Omiya"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533077,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Seoul"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533083,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"West Virginia"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533122,
"dbSnpId": "rs137852327",
"call": "C/C",
"alleles": [
"Ananindeua",
"Hechi",
"Viangchan, Jammu"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533586,
"dbSnpId": "rs74575103",
"call": "C/C",
"alleles": [
"Montalbano"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533587,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Osaka"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533589,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Piotrkow"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533591,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Papua"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533592,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Mizushima"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533596,
"dbSnpId": "rs137852318",
"call": "C/C",
"alleles": [
"Bajo Maumere",
"Seattle, Lodi, Modena, Ferrara II, Athens-like"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533605,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Chinese-1",
"Haikou"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533607,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Wexham"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533608,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"La Jolla"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533614,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Sugao"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533615,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Bangkok"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533619,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Lille"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533620,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Cleveland Corum"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533629,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Roubaix"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533634,
"dbSnpId": "rs137852346",
"call": "C/C",
"alleles": [
"Aveiro"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534036,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Wayne"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534074,
"dbSnpId": null,
"call": "TCAGTGC/TCAGTGC",
"alleles": [
"Stonybrook"
],
"phased": false,
"wildtypeAllele": "TCAGTGC",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534092,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Durham"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534102,
"dbSnpId": "rs782757170",
"call": "G/G",
"alleles": [
"Nanning"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534110,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Asahikawa"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534116,
"dbSnpId": null,
"call": "ATGT/ATGT",
"alleles": [
"North Dallas"
],
"phased": false,
"wildtypeAllele": "ATGT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534125,
"dbSnpId": "rs137852328",
"call": "C/C",
"alleles": [
"A- 680T_376G",
"Mexico City"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534126,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Radlowo"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534157,
"dbSnpId": "rs137852319",
"call": "A/A",
"alleles": [
"Harilaou"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534345,
"dbSnpId": "rs137852326",
"call": "C/C",
"alleles": [
"Cincinnati",
"Minnesota, Marion, Gastonia, LeJeune"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534348,
"dbSnpId": "rs782754619",
"call": "T/T",
"alleles": [
"Sibari"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534387,
"dbSnpId": "rs781865768",
"call": "T/T",
"alleles": [
"Dagua"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534389,
"dbSnpId": "rs137852332",
"call": "C/C",
"alleles": [
"Nilgiri",
"Santiago"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534390,
"dbSnpId": "rs137852330",
"call": "G/G",
"alleles": [
"Coimbra Shunde",
"Vancouver"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534409,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Pedoplis-Ckaro"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534414,
"dbSnpId": null,
"call": "GGGA/GGGA",
"alleles": [
"Tsukui"
],
"phased": false,
"wildtypeAllele": "GGGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534419,
"dbSnpId": "rs5030868",
"call": "G/G",
"alleles": [
"Mediterranean, Dallas, Panama, Sassari, Cagliari, Birmingham"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534438,
"dbSnpId": "rs267606836",
"call": "G/G",
"alleles": [
"Vancouver"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534440,
"dbSnpId": "rs5030872",
"call": "T/T",
"alleles": [
"Malaga",
"Santa Maria"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534447,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Chikugo"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534455,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Shinshu"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534463,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Miaoli"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534465,
"dbSnpId": "rs137852343",
"call": "A/A",
"alleles": [
"Nankang"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534468,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Volendam"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534485,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Naone"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534486,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Toledo"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534489,
"dbSnpId": "rs137852331",
"call": "T/T",
"alleles": [
"Taipei, Chinese-3"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534494,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Plymouth"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534495,
"dbSnpId": "rs137852314",
"call": "C/C",
"alleles": [
"Mahidol"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535176,
"dbSnpId": "rs370918918",
"call": "C/C",
"alleles": [
"Gond"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535180,
"dbSnpId": "rs782487723",
"call": "C/C",
"alleles": [
"Shenzen"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535187,
"dbSnpId": "rs137852313",
"call": "C/C",
"alleles": [
"Ilesha"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535190,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Acrokorinthos"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535211,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Liuzhou"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535244,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Belem"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535247,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Valladolid"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535249,
"dbSnpId": "rs782322505",
"call": "T/T",
"alleles": [
"Cairo"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535261,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Quing Yan"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535269,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Crispim"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535270,
"dbSnpId": "rs78365220",
"call": "A/A",
"alleles": [
"Crispim",
"Salerno Pyrgos",
"Vanua Lava"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535274,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Crispim"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535277,
"dbSnpId": "rs1050829",
"call": "T/T",
"alleles": [
"202G>A_376A>G_1264C>G",
"A",
"A- 202A_376G",
"A- 680T_376G",
"A- 968C_376G",
"Acrokorinthos",
"Ananindeua",
"Mt Sinai",
"Santa Maria",
"Sierra Leone"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535278,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Crispim"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535301,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Bao Loc"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535316,
"dbSnpId": "rs5030870",
"call": "C/C",
"alleles": [
"Sao Borja"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535330,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Hammersmith"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535336,
"dbSnpId": "rs267606835",
"call": "G/G",
"alleles": [
"Vancouver"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535342,
"dbSnpId": "rs181277621",
"call": "C/C",
"alleles": [
"Sierra Leone"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535367,
"dbSnpId": null,
"call": "GCTT/GCTT",
"alleles": [
"Urayasu"
],
"phased": false,
"wildtypeAllele": "GCTT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535379,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Guangzhou"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535962,
"dbSnpId": "rs782308266",
"call": "C/C",
"alleles": [
"Lagosanto"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535963,
"dbSnpId": "rs138687036",
"call": "G/G",
"alleles": [
"Ube Konan"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535980,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Swansea"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535995,
"dbSnpId": "rs782090947",
"call": "T/T",
"alleles": [
"Murcia Oristano"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535996,
"dbSnpId": "rs137852349",
"call": "A/A",
"alleles": [
"Namouru"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536002,
"dbSnpId": "rs1050828",
"call": "C/C",
"alleles": [
"202G>A_376A>G_1264C>G",
"A- 202A_376G",
"Asahi",
"Hechi"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536008,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Songklanagarind"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536019,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Amazonia",
"Musashino"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536021,
"dbSnpId": null,
"call": "CAGA/CAGA",
"alleles": [
"Amsterdam"
],
"phased": false,
"wildtypeAllele": "CAGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536025,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Costanzo"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536032,
"dbSnpId": "rs137852315",
"call": "C/C",
"alleles": [
"Metaponto"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536034,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Palestrina"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536035,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Kamogawa"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536045,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Kozukata"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536151,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Kambos"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536156,
"dbSnpId": "rs76645461",
"call": "A/A",
"alleles": [
"Aures"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536168,
"dbSnpId": "rs78478128",
"call": "G/G",
"alleles": [
"Orissa"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536169,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Rignano"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546045,
"dbSnpId": "rs137852338",
"call": "CATG/CATG",
"alleles": [
"Sunderland"
],
"phased": false,
"wildtypeAllele": "CATG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546046,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Gidra"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546057,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Honiara"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546061,
"dbSnpId": "rs137852340",
"call": "T/T",
"alleles": [
"Gaohe"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546116,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Lages"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546122,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Sinnai"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546131,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"No name"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"HLA-A": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": null,
"phenotypeSource": "CPIC",
"geneSymbol": "HLA-A",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "NONE",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "carbamazepine",
"id": "PA448785"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-A",
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-A",
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"HLA-B": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": null,
"phenotypeSource": "CPIC",
"geneSymbol": "HLA-B",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "OUTSIDE",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "pcat-outside-call",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "",
"message": "This comes from an outside data source which does not supply position-level detail. For specific disclaimers and limitations, see the original genotyping source."
}
],
"relatedDrugs": [
{
"name": "abacavir",
"id": "PA448004"
},
{
"name": "allopurinol",
"id": "PA448320"
},
{
"name": "carbamazepine",
"id": "PA448785"
},
{
"name": "fosphenytoin",
"id": "PA164746820"
},
{
"name": "oxcarbazepine",
"id": "PA450732"
},
{
"name": "phenytoin",
"id": "PA450947"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"IFNL3": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "IFNL3",
"chr": "chr19",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "IFNL3 reverse complement footnote",
"version": "1",
"matches": {
"gene": "IFNL3",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The IFNL3 gene is on the negative chromosomal strand, all genotype calls for IFNL3 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
}
],
"relatedDrugs": [
{
"name": "peginterferon alfa-2a",
"id": "PA164749390"
},
{
"name": "peginterferon alfa-2b",
"id": "PA164784024"
},
{
"name": "ribavirin",
"id": "PA451241"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "IFNL3",
"name": "rs12979860 reference (C)",
"function": "Favorable response allele",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "IFNL3",
"name": "rs12979860 reference (C)",
"function": "Favorable response allele",
"reference": true,
"activityValue": "n/a"
},
"gene": "IFNL3",
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs12979860 reference (C)/rs12979860 reference (C)",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "IFNL3",
"name": "rs12979860 reference (C)",
"function": "Favorable response allele",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "IFNL3",
"name": "rs12979860 reference (C)",
"function": "Favorable response allele",
"reference": true,
"activityValue": "n/a"
},
"gene": "IFNL3",
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs12979860 reference (C)/rs12979860 reference (C)",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "IFNL3",
"chromosome": "chr19",
"position": 39248147,
"dbSnpId": "rs12979860",
"call": "C/C",
"alleles": [
"rs12979860 variant (T)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"MT-RNR1": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "MT-RNR1",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "OUTSIDE",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "pcat-outside-call",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "",
"message": "This comes from an outside data source which does not supply position-level detail. For specific disclaimers and limitations, see the original genotyping source."
}
],
"relatedDrugs": [
{
"name": "amikacin",
"id": "PA164744372"
},
{
"name": "gentamicin",
"id": "PA449753"
},
{
"name": "kanamycin",
"id": "PA450137"
},
{
"name": "paromomycin",
"id": "PA164784023"
},
{
"name": "plazomicin",
"id": "PA166228921"
},
{
"name": "streptomycin",
"id": "PA451512"
},
{
"name": "tobramycin",
"id": "PA451704"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "MT-RNR1",
"name": "1555A>G",
"function": "Unassigned function",
"reference": false,
"activityValue": "n/a"
},
"allele2": null,
"gene": "MT-RNR1",
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "1555A>G",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "MT-RNR1",
"name": "1555A>G",
"function": "Unassigned function",
"reference": false,
"activityValue": "n/a"
},
"allele2": null,
"gene": "MT-RNR1",
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "1555A>G",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"NUDT15": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "NUDT15",
"chr": "chr13",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The NUDT15 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "azathioprine",
"id": "PA448515"
},
{
"name": "mercaptopurine",
"id": "PA450379"
},
{
"name": "thioguanine",
"id": "PA451663"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037748,
"dbSnpId": "rs769369441",
"call": "T/T",
"alleles": [
"*10"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037749,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037782,
"dbSnpId": "rs746071566",
"call": "AGGAGTC/AGGAGTC",
"alleles": [
"*2",
"*6",
"*9"
],
"phased": false,
"wildtypeAllele": "AGGAGTC",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037798,
"dbSnpId": "rs186364861",
"call": "G/G",
"alleles": [
"*5"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037825,
"dbSnpId": "rs777311140",
"call": "C/C",
"alleles": [
"*14"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037834,
"dbSnpId": "rs1202487323",
"call": "C/C",
"alleles": [
"*16"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037847,
"dbSnpId": "rs766023281",
"call": "G/G",
"alleles": [
"*7"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037849,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*8"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037885,
"dbSnpId": "rs1950545307",
"call": "G/G",
"alleles": [
"*11"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037902,
"dbSnpId": "rs149436418",
"call": "C/C",
"alleles": [
"*12"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48040977,
"dbSnpId": "rs1457579126",
"call": "GA/GA",
"alleles": [
"*18"
],
"phased": false,
"wildtypeAllele": "GA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48041103,
"dbSnpId": "rs761191455",
"call": "T/T",
"alleles": [
"*13"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48041113,
"dbSnpId": "rs1368252918",
"call": "G/G",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045690,
"dbSnpId": "rs768324690",
"call": "C/C",
"alleles": [
"*20"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045719,
"dbSnpId": "rs116855232",
"call": "C/C",
"alleles": [
"*2",
"*3"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045720,
"dbSnpId": "rs147390019",
"call": "G/G",
"alleles": [
"*4"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045771,
"dbSnpId": "rs139551410",
"call": "T/T",
"alleles": [
"*15"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"RYR1": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "RYR1",
"chr": "chr19",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The RYR1 Reference allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "desflurane",
"id": "PA164749136"
},
{
"name": "enflurane",
"id": "PA449461"
},
{
"name": "halothane",
"id": "PA449845"
},
{
"name": "isoflurane",
"id": "PA450106"
},
{
"name": "methoxyflurane",
"id": "PA450434"
},
{
"name": "sevoflurane",
"id": "PA451341"
},
{
"name": "succinylcholine",
"id": "PA451522"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": null,
"gene": "RYR1",
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38433867,
"dbSnpId": "rs193922744",
"call": "T/T",
"alleles": [
"c.38T>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440747,
"dbSnpId": "rs193922745",
"call": "CGAT/CGAT",
"alleles": [
"c.51_53del"
],
"phased": false,
"wildtypeAllele": "CGAT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440796,
"dbSnpId": "rs193922746",
"call": "A/A",
"alleles": [
"c.97A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440802,
"dbSnpId": "rs193922747",
"call": "T/T",
"alleles": [
"c.103T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440818,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.119G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440829,
"dbSnpId": "rs193922748",
"call": "C/C",
"alleles": [
"c.130C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440830,
"dbSnpId": "rs139161723",
"call": "G/G",
"alleles": [
"c.131G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440851,
"dbSnpId": "rs193922749",
"call": "C/C",
"alleles": [
"c.152C>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38442361,
"dbSnpId": "rs118192160",
"call": "G/G",
"alleles": [
"c.178G>A",
"c.178G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38442373,
"dbSnpId": "rs995399438",
"call": "T/T",
"alleles": [
"c.190T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38442395,
"dbSnpId": "rs118192113",
"call": "C/C",
"alleles": [
"c.212C>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38442434,
"dbSnpId": "rs186983396",
"call": "C/C",
"alleles": [
"c.251C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38443790,
"dbSnpId": "rs142474192",
"call": "G/G",
"alleles": [
"c.418G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444179,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.455C>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444187,
"dbSnpId": "rs193922750",
"call": "C/C",
"alleles": [
"c.463C>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444191,
"dbSnpId": "rs193922751",
"call": "G/G",
"alleles": [
"c.467G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444203,
"dbSnpId": "rs193922752",
"call": "A/A",
"alleles": [
"c.479A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444211,
"dbSnpId": "rs118192161",
"call": "C/C",
"alleles": [
"c.487C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444212,
"dbSnpId": "rs193922753",
"call": "G/G",
"alleles": [
"c.488G>A",
"c.488G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444217,
"dbSnpId": "rs193922754",
"call": "G/G",
"alleles": [
"c.493G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444220,
"dbSnpId": "rs193922755",
"call": "G/G",
"alleles": [
"c.496G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444221,
"dbSnpId": "rs193922756",
"call": "A/A",
"alleles": [
"c.497A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444250,
"dbSnpId": "rs761616815",
"call": "G/G",
"alleles": [
"c.526G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444252,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.528G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444253,
"dbSnpId": "rs193922757",
"call": "C/C",
"alleles": [
"c.529C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444257,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.533A>C",
"c.533A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444671,
"dbSnpId": "rs771058055",
"call": "G/G",
"alleles": [
"c.625G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446481,
"dbSnpId": "rs727504129",
"call": "C/C",
"alleles": [
"c.641C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446492,
"dbSnpId": "rs193922759",
"call": "G/G",
"alleles": [
"c.652G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446517,
"dbSnpId": "rs112596687",
"call": "T/T",
"alleles": [
"c.677T>A"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446520,
"dbSnpId": "rs193922760",
"call": "A/A",
"alleles": [
"c.680A>T"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446710,
"dbSnpId": "rs1801086",
"call": "G/G",
"alleles": [
"c.742G>A",
"c.742G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448500,
"dbSnpId": "rs752652072",
"call": "C/C",
"alleles": [
"c.946C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448501,
"dbSnpId": "rs193922761",
"call": "G/G",
"alleles": [
"c.947G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448673,
"dbSnpId": "rs193922762",
"call": "C/C",
"alleles": [
"c.982C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448680,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.992_994dup"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448712,
"dbSnpId": "rs121918592",
"call": "G/G",
"alleles": [
"c.1021G>A",
"c.1021G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448715,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.1024G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448791,
"dbSnpId": "rs113332073",
"call": "G/G",
"alleles": [
"c.1100G>A",
"c.1100G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38451785,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.1144C>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38451842,
"dbSnpId": "rs193922764",
"call": "C/C",
"alleles": [
"c.1201C>A",
"c.1201C>G",
"c.1201C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38451843,
"dbSnpId": "rs193922766",
"call": "G/G",
"alleles": [
"c.1202G>A",
"c.1202G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38451850,
"dbSnpId": "rs118192116",
"call": "C/C",
"alleles": [
"c.1209C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38452985,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.1411C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38452996,
"dbSnpId": "rs193922767",
"call": "G/G",
"alleles": [
"c.1422G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455247,
"dbSnpId": "rs147723844",
"call": "A/A",
"alleles": [
"c.1453A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455253,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.1459C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455254,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.1460T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455269,
"dbSnpId": "rs901087791",
"call": "G/G",
"alleles": [
"c.1475G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455347,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.1553T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455359,
"dbSnpId": "rs118192162",
"call": "A/A",
"alleles": [
"c.1565A>C",
"c.1565A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455463,
"dbSnpId": "rs111888148",
"call": "G/G",
"alleles": [
"c.1589G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455471,
"dbSnpId": "rs193922768",
"call": "C/C",
"alleles": [
"c.1597C>A",
"c.1597C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455472,
"dbSnpId": "rs144336148",
"call": "G/G",
"alleles": [
"c.1598G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455489,
"dbSnpId": "rs193922769",
"call": "T/T",
"alleles": [
"c.1615T>C",
"c.1615T>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455504,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.1630G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455528,
"dbSnpId": "rs193922770",
"call": "C/C",
"alleles": [
"c.1654C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38457539,
"dbSnpId": "rs118204423",
"call": "G/G",
"alleles": [
"c.1834G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38457545,
"dbSnpId": "rs118192172",
"call": "C/C",
"alleles": [
"c.1840C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38457546,
"dbSnpId": "rs193922772",
"call": "G/G",
"alleles": [
"c.1841G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38458175,
"dbSnpId": "rs747177274",
"call": "G/G",
"alleles": [
"c.2050G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38458247,
"dbSnpId": "rs138874610",
"call": "G/G",
"alleles": [
"c.2122G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38460461,
"dbSnpId": "rs376149732",
"call": "C/C",
"alleles": [
"c.2447C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38460551,
"dbSnpId": "rs193922775",
"call": "C/C",
"alleles": [
"c.2537C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38463499,
"dbSnpId": "rs370634440",
"call": "G/G",
"alleles": [
"c.2654G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38464649,
"dbSnpId": "rs148623597",
"call": "G/G",
"alleles": [
"c.2797G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466144,
"dbSnpId": "rs778241277",
"call": "G/G",
"alleles": [
"c.2924G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466216,
"dbSnpId": "rs180714609",
"call": "G/G",
"alleles": [
"c.2996G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466315,
"dbSnpId": "rs141942845",
"call": "G/G",
"alleles": [
"c.3095G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466347,
"dbSnpId": "rs111272095",
"call": "C/C",
"alleles": [
"c.3127C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466386,
"dbSnpId": "rs2145447772",
"call": "G/G",
"alleles": [
"c.3166G>A",
"c.3166G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466392,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.3172G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38467655,
"dbSnpId": "rs749040743",
"call": "G/G",
"alleles": [
"c.3224G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38469002,
"dbSnpId": "rs193922776",
"call": "C/C",
"alleles": [
"c.3418C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38469111,
"dbSnpId": "rs549201486",
"call": "C/C",
"alleles": [
"c.3527C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38469404,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.3656A>C"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38469415,
"dbSnpId": "rs936513262",
"call": "G/G",
"alleles": [
"c.3667G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38473635,
"dbSnpId": "rs34694816",
"call": "A/A",
"alleles": [
"c.4024A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38475335,
"dbSnpId": "rs137933390",
"call": "A/A",
"alleles": [
"c.4178A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38477816,
"dbSnpId": "rs145573319",
"call": "A/A",
"alleles": [
"c.4400A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38483293,
"dbSnpId": "rs146429605",
"call": "A/A",
"alleles": [
"c.4711A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38483329,
"dbSnpId": "rs754476250",
"call": "C/C",
"alleles": [
"c.4747C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38483345,
"dbSnpId": "rs151029675",
"call": "C/C",
"alleles": [
"c.4763C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38483357,
"dbSnpId": "rs193922777",
"call": "C/C",
"alleles": [
"c.4775C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485679,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.5024T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485688,
"dbSnpId": "rs781104539",
"call": "A/A",
"alleles": [
"c.5033A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485691,
"dbSnpId": "rs146504767",
"call": "G/G",
"alleles": [
"c.5036G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485787,
"dbSnpId": "rs754785770",
"call": "A/A",
"alleles": [
"c.5132A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485838,
"dbSnpId": "rs193922781",
"call": "C/C",
"alleles": [
"c.5183C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485841,
"dbSnpId": "rs193922782",
"call": "T/T",
"alleles": [
"c.5186T>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485972,
"dbSnpId": "rs192863857",
"call": "C/C",
"alleles": [
"c.5317C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485996,
"dbSnpId": "rs372958050",
"call": "T/T",
"alleles": [
"c.5341T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38486015,
"dbSnpId": "rs34934920",
"call": "C/C",
"alleles": [
"c.5360C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38486095,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.5440A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38486096,
"dbSnpId": "rs193922783",
"call": "T/T",
"alleles": [
"c.5441T>A"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38490151,
"dbSnpId": "rs145801146",
"call": "C/C",
"alleles": [
"c.5890C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38490642,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.6037A>C"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38492540,
"dbSnpId": "rs35364374",
"call": "G/G",
"alleles": [
"c.6178G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494379,
"dbSnpId": "rs746818096",
"call": "T/T",
"alleles": [
"c.6302T>A"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494381,
"dbSnpId": "rs770593660",
"call": "G/G",
"alleles": [
"c.6304G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494426,
"dbSnpId": "rs193922788",
"call": "G/G",
"alleles": [
"c.6349G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494454,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.6377G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494464,
"dbSnpId": "rs117886618",
"call": "C/C",
"alleles": [
"c.6387C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494465,
"dbSnpId": "rs193922789",
"call": "G/G",
"alleles": [
"c.6388G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494555,
"dbSnpId": "rs143398211",
"call": "G/G",
"alleles": [
"c.6478G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494564,
"dbSnpId": "rs118192175",
"call": "C/C",
"alleles": [
"c.6487C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494565,
"dbSnpId": "rs118192163",
"call": "G/G",
"alleles": [
"c.6488G>A",
"c.6488G>C",
"c.6488G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494579,
"dbSnpId": "rs118192176",
"call": "G/G",
"alleles": [
"c.6502G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494621,
"dbSnpId": "rs193922790",
"call": "A/A",
"alleles": [
"c.6544A>T"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494625,
"dbSnpId": "rs959170123",
"call": "G/G",
"alleles": [
"c.6548G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496265,
"dbSnpId": "rs193922791",
"call": "C/C",
"alleles": [
"c.6599C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496278,
"dbSnpId": "rs141646642",
"call": "C/C",
"alleles": [
"c.6612C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496283,
"dbSnpId": "rs118192177",
"call": "C/C",
"alleles": [
"c.6617C>G",
"c.6617C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496294,
"dbSnpId": "rs193922792",
"call": "G/G",
"alleles": [
"c.6628G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496301,
"dbSnpId": "rs193922793",
"call": "T/T",
"alleles": [
"c.6635T>A"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496306,
"dbSnpId": "rs193922795",
"call": "G/G",
"alleles": [
"c.6640G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496415,
"dbSnpId": "rs199870223",
"call": "C/C",
"alleles": [
"c.6670C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496416,
"dbSnpId": "rs537994744",
"call": "G/G",
"alleles": [
"c.6671G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496455,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.6710G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496487,
"dbSnpId": "rs763352221",
"call": "C/C",
"alleles": [
"c.6742C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496488,
"dbSnpId": "rs140152019",
"call": "G/G",
"alleles": [
"c.6743G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496502,
"dbSnpId": "rs917523269",
"call": "C/C",
"alleles": [
"c.6757C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496901,
"dbSnpId": "rs193922797",
"call": "G/G",
"alleles": [
"c.6838G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496910,
"dbSnpId": "rs118192121",
"call": "A/A",
"alleles": [
"c.6847A>C"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499177,
"dbSnpId": "rs34390345",
"call": "A/A",
"alleles": [
"c.6961A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499223,
"dbSnpId": "rs112563513",
"call": "G/G",
"alleles": [
"c.7007G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499234,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.7018T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499241,
"dbSnpId": "rs147213895",
"call": "A/A",
"alleles": [
"c.7025A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499639,
"dbSnpId": "rs193922798",
"call": "G/G",
"alleles": [
"c.7032G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499642,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.7035C>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499643,
"dbSnpId": "rs193922799",
"call": "G/G",
"alleles": [
"c.7036G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499644,
"dbSnpId": "rs121918596",
"call": "TGGA/TGGA",
"alleles": [
"c.7042_7044delGAG"
],
"phased": false,
"wildtypeAllele": "TGGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499650,
"dbSnpId": "rs193922801",
"call": "A/A",
"alleles": [
"c.7043A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499655,
"dbSnpId": "rs193922802",
"call": "G/G",
"alleles": [
"c.7048G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499667,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.7060G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499670,
"dbSnpId": "rs193922803",
"call": "C/C",
"alleles": [
"c.7063C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499680,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.7073T>A"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499682,
"dbSnpId": "rs769482889",
"call": "C/C",
"alleles": [
"c.7075C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499683,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.7076G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499691,
"dbSnpId": "rs762401851",
"call": "G/G",
"alleles": [
"c.7084G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499692,
"dbSnpId": "rs193922804",
"call": "A/A",
"alleles": [
"c.7085A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499696,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.7089C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499697,
"dbSnpId": "rs193922805",
"call": "T/T",
"alleles": [
"c.7090T>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499704,
"dbSnpId": "rs193922806",
"call": "C/C",
"alleles": [
"c.7097C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499706,
"dbSnpId": "rs146306934",
"call": "G/G",
"alleles": [
"c.7099G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499719,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.7112A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499730,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.7123G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499731,
"dbSnpId": "rs193922807",
"call": "G/G",
"alleles": [
"c.7124G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499806,
"dbSnpId": "rs976108591",
"call": "A/A",
"alleles": [
"c.7199A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499817,
"dbSnpId": "rs111364296",
"call": "G/G",
"alleles": [
"c.7210G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499975,
"dbSnpId": "rs193922809",
"call": "G/G",
"alleles": [
"c.7282G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499984,
"dbSnpId": "rs193922810",
"call": "G/G",
"alleles": [
"c.7291G>A",
"c.7291G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499985,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.7292A>T"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499993,
"dbSnpId": "rs121918593",
"call": "G/G",
"alleles": [
"c.7300G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499997,
"dbSnpId": "rs28933396",
"call": "G/G",
"alleles": [
"c.7304G>A",
"c.7304G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500000,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.7307G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500003,
"dbSnpId": "rs193922812",
"call": "C/C",
"alleles": [
"c.7310C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500010,
"dbSnpId": "rs193922813",
"call": "G/G",
"alleles": [
"c.7317G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500636,
"dbSnpId": "rs118192124",
"call": "C/C",
"alleles": [
"c.7354C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500637,
"dbSnpId": "rs193922815",
"call": "G/G",
"alleles": [
"c.7355G>A",
"c.7355G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500640,
"dbSnpId": "rs118192123",
"call": "T/T",
"alleles": [
"c.7358T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500642,
"dbSnpId": "rs193922816",
"call": "C/C",
"alleles": [
"c.7360C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500643,
"dbSnpId": "rs118192122",
"call": "G/G",
"alleles": [
"c.7361G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500654,
"dbSnpId": "rs28933397",
"call": "C/C",
"alleles": [
"c.7372C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500655,
"dbSnpId": "rs121918594",
"call": "G/G",
"alleles": [
"c.7373G>A",
"c.7373G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500667,
"dbSnpId": "rs551223467",
"call": "C/C",
"alleles": [
"c.7385C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500863,
"dbSnpId": "rs193922817",
"call": "C/C",
"alleles": [
"c.7487C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500898,
"dbSnpId": "rs118192178",
"call": "C/C",
"alleles": [
"c.7522C>G",
"c.7522C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500899,
"dbSnpId": "rs193922818",
"call": "G/G",
"alleles": [
"c.7523G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500904,
"dbSnpId": "rs193922819",
"call": "T/T",
"alleles": [
"c.7528T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502652,
"dbSnpId": "rs767553612",
"call": "A/A",
"alleles": [
"c.7760A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502663,
"dbSnpId": "rs193922822",
"call": "C/C",
"alleles": [
"c.7771C>G",
"c.7771C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502669,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.7777C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502670,
"dbSnpId": "rs751180702",
"call": "G/G",
"alleles": [
"c.7778G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502679,
"dbSnpId": "rs193922824",
"call": "C/C",
"alleles": [
"c.7787C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502708,
"dbSnpId": "rs748575133",
"call": "T/T",
"alleles": [
"c.7816T>A"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502923,
"dbSnpId": "rs914804033",
"call": "G/G",
"alleles": [
"c.7879G>A",
"c.7879G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504298,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.8005G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504319,
"dbSnpId": "rs193922826",
"call": "C/C",
"alleles": [
"c.8026C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504347,
"dbSnpId": "rs781126470",
"call": "C/C",
"alleles": [
"c.8054C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504868,
"dbSnpId": "rs193922827",
"call": "G/G",
"alleles": [
"c.8188G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504869,
"dbSnpId": "rs112196644",
"call": "A/A",
"alleles": [
"c.8189A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504878,
"dbSnpId": "rs193922828",
"call": "G/G",
"alleles": [
"c.8198G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505061,
"dbSnpId": "rs193922829",
"call": "G/G",
"alleles": [
"c.8290G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505325,
"dbSnpId": "rs147707463",
"call": "C/C",
"alleles": [
"c.8327C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505358,
"dbSnpId": "rs35180584",
"call": "C/C",
"alleles": [
"c.8360C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505923,
"dbSnpId": "rs193922830",
"call": "C/C",
"alleles": [
"c.8518C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505932,
"dbSnpId": "rs768535909",
"call": "T/T",
"alleles": [
"c.8527T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38506361,
"dbSnpId": "rs193922831",
"call": "T/T",
"alleles": [
"c.8600T>A"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38506492,
"dbSnpId": "rs112772310",
"call": "G/G",
"alleles": [
"c.8638G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38506508,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.8654C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38506865,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.8729C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38507821,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.8926C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38511590,
"dbSnpId": "rs147303895",
"call": "G/G",
"alleles": [
"c.9152G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38512279,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.9268G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38512321,
"dbSnpId": "rs193922832",
"call": "G/G",
"alleles": [
"c.9310G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38512367,
"dbSnpId": "rs193922833",
"call": "G/G",
"alleles": [
"c.9356G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38515052,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.9499C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38516167,
"dbSnpId": "rs199738299",
"call": "A/A",
"alleles": [
"c.9635A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38516181,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.9649T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38516184,
"dbSnpId": "rs553055844",
"call": "G/G",
"alleles": [
"c.9652G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38516208,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.9676G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517431,
"dbSnpId": "rs375626634",
"call": "T/T",
"alleles": [
"c.9758T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517470,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.9797T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517521,
"dbSnpId": "rs757753317",
"call": "G/G",
"alleles": [
"c.9848G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517523,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.9850T>A"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517541,
"dbSnpId": "rs112151058",
"call": "G/G",
"alleles": [
"c.9868G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519237,
"dbSnpId": "rs118204421",
"call": "C/C",
"alleles": [
"c.10042C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519238,
"dbSnpId": "rs193922834",
"call": "G/G",
"alleles": [
"c.10043G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519292,
"dbSnpId": "rs137932199",
"call": "G/G",
"alleles": [
"c.10097G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519295,
"dbSnpId": "rs118192126",
"call": "A/A",
"alleles": [
"c.10100A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519424,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.10229C>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519432,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.10237A>T"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519447,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.10252A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38525432,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.10556C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38525492,
"dbSnpId": "rs143987857",
"call": "G/G",
"alleles": [
"c.10616G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38527707,
"dbSnpId": "rs55876273",
"call": "G/G",
"alleles": [
"c.10747G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38527710,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.10750G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38528372,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.10891G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38529002,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.11086G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38529036,
"dbSnpId": "rs193922838",
"call": "G/G",
"alleles": [
"c.11120G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38529042,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.11126C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38529048,
"dbSnpId": "rs375915752",
"call": "C/C",
"alleles": [
"c.11132C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38534726,
"dbSnpId": "rs4802584",
"call": "C/C",
"alleles": [
"c.11266C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38534774,
"dbSnpId": "rs763112609",
"call": "C/C",
"alleles": [
"c.11314C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38534775,
"dbSnpId": "rs193922839",
"call": "G/G",
"alleles": [
"c.11315G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38535197,
"dbSnpId": "rs111565359",
"call": "G/G",
"alleles": [
"c.11416G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38535998,
"dbSnpId": "rs140616359",
"call": "G/G",
"alleles": [
"c.11518G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543365,
"dbSnpId": "rs148399313",
"call": "G/G",
"alleles": [
"c.11708G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543380,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.11723A>T"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543405,
"dbSnpId": "rs193922840",
"call": "T/T",
"alleles": [
"c.11748T>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543551,
"dbSnpId": "rs147136339",
"call": "A/A",
"alleles": [
"c.11798A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543566,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.11813G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543810,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.11947C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543816,
"dbSnpId": "rs118204422",
"call": "T/T",
"alleles": [
"c.11953T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543821,
"dbSnpId": "rs193922842",
"call": "C/C",
"alleles": [
"c.11958C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543832,
"dbSnpId": "rs193922843",
"call": "G/G",
"alleles": [
"c.11969G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38546460,
"dbSnpId": "rs755088027",
"call": "G/G",
"alleles": [
"c.12028G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38546496,
"dbSnpId": "rs773040531",
"call": "A/A",
"alleles": [
"c.12064A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38548253,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.12115A>T"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38548259,
"dbSnpId": "rs144685735",
"call": "C/C",
"alleles": [
"c.12121C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38548287,
"dbSnpId": "rs193922844",
"call": "C/C",
"alleles": [
"c.12149C>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38548380,
"dbSnpId": "rs373406011",
"call": "C/C",
"alleles": [
"c.12242C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561140,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.12310G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561185,
"dbSnpId": "rs193922848",
"call": "A/A",
"alleles": [
"c.12355A>T"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561213,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.12383C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561228,
"dbSnpId": "rs201321695",
"call": "A/A",
"alleles": [
"c.12398A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561236,
"dbSnpId": "rs193922849",
"call": "C/C",
"alleles": [
"c.12406C>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561243,
"dbSnpId": "rs193922850",
"call": "T/T",
"alleles": [
"c.12413T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561362,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.12532G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561363,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.12533G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561383,
"dbSnpId": "rs151119428",
"call": "G/G",
"alleles": [
"c.12553G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565023,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.12689T>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565034,
"dbSnpId": "rs193922852",
"call": "G/G",
"alleles": [
"c.12700G>C",
"c.12700G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565182,
"dbSnpId": "rs193922853",
"call": "A/A",
"alleles": [
"c.12848A>T"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565215,
"dbSnpId": "rs587784372",
"call": "C/C",
"alleles": [
"c.12881C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565218,
"dbSnpId": "rs193922855",
"call": "C/C",
"alleles": [
"c.12884C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38566978,
"dbSnpId": "rs139647387",
"call": "A/A",
"alleles": [
"c.13505A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38566986,
"dbSnpId": "rs150396398",
"call": "G/G",
"alleles": [
"c.13513G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38570619,
"dbSnpId": "rs771741606",
"call": "C/C",
"alleles": [
"c.13672C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38570620,
"dbSnpId": "rs118192130",
"call": "G/G",
"alleles": [
"c.13673G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38570649,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.13702C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572032,
"dbSnpId": "rs143520367",
"call": "C/C",
"alleles": [
"c.13760C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572185,
"dbSnpId": "rs118192135",
"call": "G/G",
"alleles": [
"c.13913G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572190,
"dbSnpId": "rs756850145",
"call": "A/A",
"alleles": [
"c.13918A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572206,
"dbSnpId": "rs193922860",
"call": "G/G",
"alleles": [
"c.13934G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572262,
"dbSnpId": "rs759500310",
"call": "T/T",
"alleles": [
"c.13990T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572266,
"dbSnpId": "rs193922862",
"call": "TC/TC",
"alleles": [
"c.13994_13995delTCinsCT"
],
"phased": false,
"wildtypeAllele": "TC",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38573180,
"dbSnpId": "rs193922863",
"call": "C/C",
"alleles": [
"c.14002C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38573229,
"dbSnpId": "rs193922864",
"call": "T/T",
"alleles": [
"c.14051T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38573304,
"dbSnpId": "rs118192140",
"call": "C/C",
"alleles": [
"c.14126C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38575957,
"dbSnpId": "rs200766617",
"call": "G/G",
"alleles": [
"c.14168G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577931,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.14186A>C"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577942,
"dbSnpId": "rs193922865",
"call": "T/T",
"alleles": [
"c.14197T>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577946,
"dbSnpId": "rs193922866",
"call": "G/G",
"alleles": [
"c.14201G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577954,
"dbSnpId": "rs193922867",
"call": "C/C",
"alleles": [
"c.14209C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577955,
"dbSnpId": "rs193922868",
"call": "G/G",
"alleles": [
"c.14210G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38578015,
"dbSnpId": "rs768360593",
"call": "G/G",
"alleles": [
"c.14270G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38578205,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.14364+1G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580004,
"dbSnpId": "rs118192167",
"call": "A/A",
"alleles": [
"c.14387A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580039,
"dbSnpId": null,
"call": "TT/TT",
"alleles": [
"c.14422_14423delinsAA"
],
"phased": false,
"wildtypeAllele": "TT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580041,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.14424C>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580066,
"dbSnpId": "rs143988412",
"call": "A/A",
"alleles": [
"c.14449A>T"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580075,
"dbSnpId": "rs193922873",
"call": "G/G",
"alleles": [
"c.14458G>A",
"c.14458G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580088,
"dbSnpId": "rs193922874",
"call": "T/T",
"alleles": [
"c.14471T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580094,
"dbSnpId": "rs121918595",
"call": "C/C",
"alleles": [
"c.14477C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580114,
"dbSnpId": "rs193922876",
"call": "C/C",
"alleles": [
"c.14497C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580126,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.14509C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580370,
"dbSnpId": "rs193922878",
"call": "C/C",
"alleles": [
"c.14512C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580382,
"dbSnpId": "rs193922879",
"call": "G/G",
"alleles": [
"c.14524G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580397,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.14539G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580403,
"dbSnpId": "rs118192168",
"call": "G/G",
"alleles": [
"c.14545G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580416,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.14558C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580425,
"dbSnpId": "rs193922880",
"call": "C/C",
"alleles": [
"c.14567C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580439,
"dbSnpId": "rs118192181",
"call": "C/C",
"alleles": [
"c.14581C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580440,
"dbSnpId": "rs63749869",
"call": "G/G",
"alleles": [
"c.14582G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580485,
"dbSnpId": "rs113210953",
"call": "A/A",
"alleles": [
"c.14627A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580497,
"dbSnpId": "rs193922883",
"call": "T/T",
"alleles": [
"c.14639T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38584974,
"dbSnpId": "rs118192151",
"call": "G/G",
"alleles": [
"c.14678G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38584976,
"dbSnpId": "rs193922888",
"call": "G/G",
"alleles": [
"c.14680G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38584989,
"dbSnpId": "rs118192170",
"call": "T/T",
"alleles": [
"c.14693T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585078,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.14782A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585099,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.14803G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585947,
"dbSnpId": "rs111657878",
"call": "T/T",
"alleles": [
"c.14813T>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585948,
"dbSnpId": "rs118192159",
"call": "C/C",
"alleles": [
"c.14814C>G"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585951,
"dbSnpId": "rs193922895",
"call": "C/C",
"alleles": [
"c.14817C>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585952,
"dbSnpId": "rs118192158",
"call": "G/G",
"alleles": [
"c.14818G>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585959,
"dbSnpId": "rs193922896",
"call": "G/G",
"alleles": [
"c.14825G>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38586101,
"dbSnpId": "rs193922898",
"call": "T/T",
"alleles": [
"c.14879T>A"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38586140,
"dbSnpId": "rs146876145",
"call": "C/C",
"alleles": [
"c.14918C>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38586190,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.14968A>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38587362,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.15059G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38587363,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.15060G>C"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"SLCO1B1": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "SLCO1B1",
"chr": "chr12",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The SLCO1B1 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "atorvastatin",
"id": "PA448500"
},
{
"name": "fluvastatin",
"id": "PA449688"
},
{
"name": "lovastatin",
"id": "PA450272"
},
{
"name": "pitavastatin",
"id": "PA142650384"
},
{
"name": "pravastatin",
"id": "PA451089"
},
{
"name": "rosuvastatin",
"id": "PA134308647"
},
{
"name": "simvastatin",
"id": "PA451363"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172734,
"dbSnpId": "rs139257324",
"call": "C/C",
"alleles": [
"*33"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172776,
"dbSnpId": "rs373327528",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172782,
"dbSnpId": "rs56101265",
"call": "T/T",
"alleles": [
"*2",
"*12"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21174595,
"dbSnpId": "rs56061388",
"call": "T/T",
"alleles": [
"*3",
"*13"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176804,
"dbSnpId": "rs2306283",
"call": "A/A",
"alleles": [
"*14",
"*15",
"*20",
"*24",
"*25",
"*27",
"*28",
"*29",
"*30",
"*31",
"*32",
"*33",
"*37",
"*39",
"*42",
"*43",
"*44",
"*46",
"*47"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176868,
"dbSnpId": "rs2306282",
"call": "A/A",
"alleles": [
"*16"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176871,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*38"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176879,
"dbSnpId": "rs11045819",
"call": "C/C",
"alleles": [
"*4",
"*14",
"*25",
"*32",
"*43"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176883,
"dbSnpId": "rs72559745",
"call": "A/A",
"alleles": [
"*3",
"*13"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176898,
"dbSnpId": "rs77271279",
"call": "G/G",
"alleles": [
"*41"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178612,
"dbSnpId": "rs141467543",
"call": "A/A",
"alleles": [
"*42"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178615,
"dbSnpId": "rs4149056",
"call": "T/T",
"alleles": [
"*5",
"*15",
"*40",
"*46",
"*47"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178957,
"dbSnpId": "rs79135870",
"call": "A/A",
"alleles": [
"*30"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21196951,
"dbSnpId": "rs11045852",
"call": "A/A",
"alleles": [
"*24",
"*25",
"*28",
"*32",
"*33",
"*43",
"*44"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21196975,
"dbSnpId": "rs183501729",
"call": "C/C",
"alleles": [
"*39"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21196976,
"dbSnpId": "rs11045853",
"call": "G/G",
"alleles": [
"*25",
"*28",
"*33"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21200544,
"dbSnpId": "rs72559747",
"call": "C/C",
"alleles": [
"*47"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21200595,
"dbSnpId": "rs55901008",
"call": "T/T",
"alleles": [
"*6"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202553,
"dbSnpId": "rs1228465562",
"call": "T/T",
"alleles": [
"*36"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202555,
"dbSnpId": "rs59113707",
"call": "C/C",
"alleles": [
"*27"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202649,
"dbSnpId": "rs56387224",
"call": "A/A",
"alleles": [
"*7"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202664,
"dbSnpId": "rs142965323",
"call": "G/G",
"alleles": [
"*26"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21205921,
"dbSnpId": "rs72559748",
"call": "A/A",
"alleles": [
"*8"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21205999,
"dbSnpId": "rs59502379",
"call": "G/G",
"alleles": [
"*9",
"*31"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21206031,
"dbSnpId": "rs74064213",
"call": "A/A",
"alleles": [
"*43",
"*44"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21222355,
"dbSnpId": "rs71581941",
"call": "C/C",
"alleles": [
"*45",
"*46"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239042,
"dbSnpId": "rs34671512",
"call": "A/A",
"alleles": [
"*19",
"*20",
"*40"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239077,
"dbSnpId": "rs56199088",
"call": "A/A",
"alleles": [
"*10",
"*12"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239113,
"dbSnpId": "rs55737008",
"call": "A/A",
"alleles": [
"*11",
"*13"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239145,
"dbSnpId": "rs200995543",
"call": "C/C",
"alleles": [
"*34"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239158,
"dbSnpId": "rs140790673",
"call": "C/C",
"alleles": [
"*29"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"TPMT": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "TPMT",
"chr": "chr6",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "TPMT reverse complement footnote",
"version": "1",
"matches": {
"gene": "TPMT",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The TPMT gene is on the negative chromosomal strand, all genotype calls for TPMT in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The TPMT *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "azathioprine",
"id": "PA448515"
},
{
"name": "mercaptopurine",
"id": "PA450379"
},
{
"name": "thioguanine",
"id": "PA451663"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130687,
"dbSnpId": "rs1142345",
"call": "T/T",
"alleles": [
"*3A",
"*3C",
"*41"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130694,
"dbSnpId": "rs150900439",
"call": "T/T",
"alleles": [
"*20"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130725,
"dbSnpId": "rs72552736",
"call": "A/A",
"alleles": [
"*7"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130729,
"dbSnpId": "rs139392616",
"call": "C/C",
"alleles": [
"*40"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130758,
"dbSnpId": "rs398122996",
"call": "A/A",
"alleles": [
"*37"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130762,
"dbSnpId": "rs56161402",
"call": "C/C",
"alleles": [
"*8"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130772,
"dbSnpId": "rs377085266",
"call": "A/A",
"alleles": [
"*25"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130781,
"dbSnpId": "rs1800584",
"call": "C/C",
"alleles": [
"*4"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18132136,
"dbSnpId": "rs72556347",
"call": "A/A",
"alleles": [
"*26"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18132147,
"dbSnpId": "rs79901429",
"call": "A/A",
"alleles": [
"*31"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18132163,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*36"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133845,
"dbSnpId": "rs75543815",
"call": "T/T",
"alleles": [
"*6"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133847,
"dbSnpId": "rs6921269",
"call": "C/C",
"alleles": [
"*24"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133870,
"dbSnpId": "rs772832951",
"call": "A/A",
"alleles": [
"*38"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133884,
"dbSnpId": "rs74423290",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133887,
"dbSnpId": "rs201695576",
"call": "T/T",
"alleles": [
"*44"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133890,
"dbSnpId": "rs9333570",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18138969,
"dbSnpId": "rs144041067",
"call": "C/C",
"alleles": [
"*16",
"*22"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18138970,
"dbSnpId": "rs112339338",
"call": "G/G",
"alleles": [
"*33"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18138997,
"dbSnpId": "rs1800460",
"call": "C/C",
"alleles": [
"*3A",
"*3B"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18139027,
"dbSnpId": "rs72552737",
"call": "C/C",
"alleles": [
"*10"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18139689,
"dbSnpId": "rs72552738",
"call": "C/C",
"alleles": [
"*11"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18139710,
"dbSnpId": "rs200220210",
"call": "G/G",
"alleles": [
"*12"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143597,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*19"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143606,
"dbSnpId": "rs151149760",
"call": "T/T",
"alleles": [
"*9"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143613,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*28"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143622,
"dbSnpId": "rs115106679",
"call": "C/C",
"alleles": [
"*32"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143643,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*27"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143700,
"dbSnpId": "rs753545734",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143718,
"dbSnpId": "rs111901354",
"call": "G/G",
"alleles": [
"*34"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143724,
"dbSnpId": "rs1800462",
"call": "C/C",
"alleles": [
"*2"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143728,
"dbSnpId": "rs1256618794",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147838,
"dbSnpId": "rs281874771",
"call": "G/G",
"alleles": [
"*39"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147845,
"dbSnpId": "rs777686348",
"call": "C/C",
"alleles": [
"*18"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147851,
"dbSnpId": "rs200591577",
"call": "G/G",
"alleles": [
"*21"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147856,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*35"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147910,
"dbSnpId": "rs72552740",
"call": "A/A",
"alleles": [
"*5"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149004,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149022,
"dbSnpId": "rs750424422",
"call": "C/C",
"alleles": [
"*30"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149032,
"dbSnpId": "rs759836180",
"call": "C/C",
"alleles": [
"*42"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149045,
"dbSnpId": "rs72552742",
"call": "T/T",
"alleles": [
"*13"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149126,
"dbSnpId": "rs267607275",
"call": "A/A",
"alleles": [
"*29"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149127,
"dbSnpId": "rs9333569",
"call": "T/T",
"alleles": [
"*14"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"UGT1A1": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "CPIC",
"geneSymbol": "UGT1A1",
"chr": "chr2",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "UGT1A1 repeat warning",
"version": "1",
"matches": {
"gene": "UGT1A1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "Some alleles in UGT1A1 are distinguished by a repeat sequence; some genotyping technologies may not accurately call the repeat."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The UGT1A1 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "atazanavir",
"id": "PA10251"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233759924,
"dbSnpId": "rs887829",
"call": "C/C",
"alleles": [
"*80",
"*80+*28",
"*80+*37"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233760233,
"dbSnpId": "rs3064744",
"call": "CAT/CAT",
"alleles": [
"*28",
"*36",
"*37",
"*80+*28",
"*80+*37"
],
"phased": false,
"wildtypeAllele": "CAT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233760498,
"dbSnpId": "rs4148323",
"call": "G/G",
"alleles": [
"*6"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233760973,
"dbSnpId": "rs35350960",
"call": "C/C",
"alleles": [
"*27"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"VKORC1": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": null,
"phenotypeSource": "CPIC",
"geneSymbol": "VKORC1",
"chr": "chr16",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "VKORC1 reverse complement footnote",
"version": "1",
"matches": {
"gene": "VKORC1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The VKORC1 gene is on the negative chromosomal strand, all genotype calls for VKORC1 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
}
],
"relatedDrugs": [
{
"name": "warfarin",
"id": "PA451906"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": null,
"reference": true,
"activityValue": null
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": null,
"reference": true,
"activityValue": null
},
"gene": "VKORC1",
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": null,
"reference": true,
"activityValue": null
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": null,
"reference": true,
"activityValue": null
},
"gene": "VKORC1",
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
],
"variants": [
{
"gene": "VKORC1",
"chromosome": "chr16",
"position": 31096368,
"dbSnpId": "rs9923231",
"call": "C/C",
"alleles": [
"rs9923231 variant (T)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
}
},
"DPWG": {
"ABCG2": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "ABCG2",
"chr": "chr4",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "allopurinol",
"id": "PA448320"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "ABCG2",
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "rs2231142 reference (G)/rs2231142 reference (G)",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "ABCG2",
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "rs2231142 reference (G)/rs2231142 reference (G)",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [
{
"gene": "ABCG2",
"chromosome": "chr4",
"position": 88131171,
"dbSnpId": "rs2231142",
"call": "G/G",
"alleles": [
"rs2231142 variant (T)"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2B6": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "CYP2B6",
"chr": "chr19",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP2B6 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "efavirenz",
"id": "PA449441"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991224,
"dbSnpId": "rs34223104",
"call": "T/T",
"alleles": [
"*22",
"*34",
"*35",
"*36"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991367,
"dbSnpId": "rs34883432",
"call": "A/A",
"alleles": [
"*10"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991369,
"dbSnpId": "rs8192709",
"call": "C/C",
"alleles": [
"*2",
"*10"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991381,
"dbSnpId": "rs33973337",
"call": "A/A",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991388,
"dbSnpId": "rs33980385",
"call": "A/A",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991390,
"dbSnpId": "rs33926104",
"call": "C/C",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991391,
"dbSnpId": "rs34284776",
"call": "G/G",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991441,
"dbSnpId": "rs35303484",
"call": "A/A",
"alleles": [
"*11"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004015,
"dbSnpId": "rs281864907",
"call": "T/T",
"alleles": [
"*38"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004125,
"dbSnpId": "rs36060847",
"call": "G/G",
"alleles": [
"*12"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004133,
"dbSnpId": "rs148009906",
"call": "G/G",
"alleles": [
"*44"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004158,
"dbSnpId": "rs186335453",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004303,
"dbSnpId": "rs139801276",
"call": "T/T",
"alleles": [
"*35"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004377,
"dbSnpId": "rs12721655",
"call": "A/A",
"alleles": [
"*8",
"*13"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004380,
"dbSnpId": "rs535039125",
"call": "C/C",
"alleles": [
"*39"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004381,
"dbSnpId": "rs35773040",
"call": "G/G",
"alleles": [
"*14"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004406,
"dbSnpId": "rs145884402",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006919,
"dbSnpId": "rs3826711",
"call": "C/C",
"alleles": [
"*26"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006923,
"dbSnpId": "rs36056539",
"call": "C/C",
"alleles": [
"*20"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006936,
"dbSnpId": "rs3745274",
"call": "G/G",
"alleles": [
"*6",
"*7",
"*9",
"*13",
"*19",
"*20",
"*26",
"*34",
"*36",
"*37",
"*38",
"*39",
"*40",
"*41",
"*42",
"*43"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006967,
"dbSnpId": "rs58871670",
"call": "G/G",
"alleles": [
"*45"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006968,
"dbSnpId": "rs373489637",
"call": "T/T",
"alleles": [
"*37"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41007013,
"dbSnpId": "rs36079186",
"call": "T/T",
"alleles": [
"*27",
"*35"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41009313,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*46"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41009350,
"dbSnpId": "rs45482602",
"call": "C/C",
"alleles": [
"*3"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41009358,
"dbSnpId": "rs2279343",
"call": "A/A",
"alleles": [
"*4",
"*6",
"*7",
"*13",
"*18",
"*19",
"*20",
"*26",
"*34",
"*36",
"*37",
"*38",
"*39",
"*40",
"*41",
"*42",
"*43"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41010006,
"dbSnpId": "rs139029625",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41010088,
"dbSnpId": "rs34698757",
"call": "C/C",
"alleles": [
"*28"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41010108,
"dbSnpId": "rs193922917",
"call": "C/C",
"alleles": [
"*31"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012316,
"dbSnpId": "rs28399499",
"call": "T/T",
"alleles": [
"*18"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012339,
"dbSnpId": "rs34826503",
"call": "C/C",
"alleles": [
"*19"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012393,
"dbSnpId": "rs754621576",
"call": "T/T",
"alleles": [
"*47"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012394,
"dbSnpId": "rs780991919",
"call": "A/A",
"alleles": [
"*47"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012465,
"dbSnpId": "rs34097093",
"call": "C/C",
"alleles": [
"*28"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012466,
"dbSnpId": "rs200458614",
"call": "G/G",
"alleles": [
"*40"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012471,
"dbSnpId": "rs201500445",
"call": "T/T",
"alleles": [
"*41"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012478,
"dbSnpId": "rs200238771",
"call": "T/T",
"alleles": [
"*48"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012693,
"dbSnpId": "rs35979566",
"call": "T/T",
"alleles": [
"*15"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012740,
"dbSnpId": "rs193922918",
"call": "G/G",
"alleles": [
"*32"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012803,
"dbSnpId": "rs35010098",
"call": "C/C",
"alleles": [
"*21"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016652,
"dbSnpId": "rs764288403",
"call": "G/G",
"alleles": [
"*49"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016679,
"dbSnpId": "rs374099483",
"call": "G/G",
"alleles": [
"*42"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016726,
"dbSnpId": "rs3211369",
"call": "A/A",
"alleles": [
"*23"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016741,
"dbSnpId": "rs117872433",
"call": "G/G",
"alleles": [
"*43"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016778,
"dbSnpId": "rs564083989",
"call": "G/G",
"alleles": [
"*24"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016805,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*25"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016810,
"dbSnpId": "rs3211371",
"call": "C/C",
"alleles": [
"*5",
"*7",
"*33",
"*34"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2C19": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "CYP2C19",
"chr": "chr10",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP2C19 *38 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "citalopram",
"id": "PA449015"
},
{
"name": "clomipramine",
"id": "PA449048"
},
{
"name": "clopidogrel",
"id": "PA449053"
},
{
"name": "escitalopram",
"id": "PA10074"
},
{
"name": "imipramine",
"id": "PA449969"
},
{
"name": "lansoprazole",
"id": "PA450180"
},
{
"name": "omeprazole",
"id": "PA450704"
},
{
"name": "pantoprazole",
"id": "PA450774"
},
{
"name": "sertraline",
"id": "PA451333"
},
{
"name": "voriconazole",
"id": "PA10233"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Unassigned function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Unassigned function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "*38/*38",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Unassigned function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Unassigned function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "*38/*38",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94761900,
"dbSnpId": "rs12248560",
"call": "C/C",
"alleles": [
"*1",
"*4",
"*17"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762706,
"dbSnpId": "rs28399504",
"call": "A/A",
"alleles": [
"*1",
"*4"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762712,
"dbSnpId": "rs367543002",
"call": "C/C",
"alleles": [
"*1",
"*34"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762715,
"dbSnpId": "rs367543003",
"call": "T/T",
"alleles": [
"*1",
"*34"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762755,
"dbSnpId": "rs55752064",
"call": "T/T",
"alleles": [
"*1",
"*14"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762760,
"dbSnpId": "rs17882687",
"call": "A/A",
"alleles": [
"*1",
"*15",
"*28",
"*35",
"*39"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762788,
"dbSnpId": "rs1564656981",
"call": "A/A",
"alleles": [
"*1",
"*29"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762856,
"dbSnpId": "rs1564657013",
"call": "A/A",
"alleles": [
"*1",
"*19"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775106,
"dbSnpId": "rs145328984",
"call": "C/C",
"alleles": [
"*1",
"*30"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775121,
"dbSnpId": "rs1564660997",
"call": "C/C",
"alleles": [
"*1",
"*31"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775160,
"dbSnpId": "rs118203756",
"call": "G/G",
"alleles": [
"*1",
"*23"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775185,
"dbSnpId": "rs1288601658",
"call": "A/A",
"alleles": [
"*1",
"*32"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775367,
"dbSnpId": "rs12769205",
"call": "A/A",
"alleles": [
"*1",
"*2",
"*35"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775416,
"dbSnpId": "rs41291556",
"call": "T/T",
"alleles": [
"*1",
"*8"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775423,
"dbSnpId": "rs17885179",
"call": "A/A",
"alleles": [
"*1",
"*39"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775453,
"dbSnpId": "rs72552267",
"call": "G/G",
"alleles": [
"*1",
"*6"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775489,
"dbSnpId": "rs17884712",
"call": "G/G",
"alleles": [
"*1",
"*9"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775507,
"dbSnpId": "rs58973490",
"call": "G/G",
"alleles": [
"*1",
"*2",
"*11"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780574,
"dbSnpId": "rs140278421",
"call": "G/G",
"alleles": [
"*1",
"*22"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780579,
"dbSnpId": "rs370803989",
"call": "G/G",
"alleles": [
"*1",
"*33"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780653,
"dbSnpId": "rs4986893",
"call": "G/G",
"alleles": [
"*1",
"*3"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781858,
"dbSnpId": "rs6413438",
"call": "C/C",
"alleles": [
"*1",
"*10"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781859,
"dbSnpId": "rs4244285",
"call": "G/G",
"alleles": [
"*1",
"*2"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781944,
"dbSnpId": "rs375781227",
"call": "G/G",
"alleles": [
"*1",
"*26"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781999,
"dbSnpId": "rs72558186",
"call": "T/T",
"alleles": [
"*1",
"*7"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842861,
"dbSnpId": "rs138142612",
"call": "G/G",
"alleles": [
"*1",
"*18"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842866,
"dbSnpId": "rs3758581",
"call": "A/A",
"alleles": [
"*1",
"*2",
"*3",
"*4",
"*5",
"*6",
"*7",
"*8",
"*9",
"*10",
"*11",
"*12",
"*13",
"*14",
"*15",
"*17",
"*18",
"*19",
"*22",
"*23",
"*24",
"*25",
"*26",
"*28",
"*29",
"*31",
"*32",
"*33",
"*35",
"*39"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842879,
"dbSnpId": "rs118203757",
"call": "G/G",
"alleles": [
"*1",
"*24"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842995,
"dbSnpId": "rs113934938",
"call": "G/G",
"alleles": [
"*1",
"*28"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94849995,
"dbSnpId": "rs17879685",
"call": "C/C",
"alleles": [
"*1",
"*13"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852738,
"dbSnpId": "rs56337013",
"call": "C/C",
"alleles": [
"*1",
"*5"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852765,
"dbSnpId": "rs192154563",
"call": "C/C",
"alleles": [
"*1",
"*16"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852785,
"dbSnpId": "rs118203759",
"call": "C/C",
"alleles": [
"*1",
"*25"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852914,
"dbSnpId": "rs55640102",
"call": "A/A",
"alleles": [
"*1",
"*12"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2C9": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "CYP2C9",
"chr": "chr10",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP2C9 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "phenytoin",
"id": "PA450947"
},
{
"name": "siponimod",
"id": "PA166182736"
},
{
"name": "warfarin",
"id": "PA451906"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C9",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C9",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938683,
"dbSnpId": "rs114071557",
"call": "A/A",
"alleles": [
"*36"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938719,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*80"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938737,
"dbSnpId": "rs67807361",
"call": "C/C",
"alleles": [
"*7"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938771,
"dbSnpId": "rs142240658",
"call": "C/C",
"alleles": [
"*21"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938788,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*83"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938800,
"dbSnpId": "rs1364419386",
"call": "G/G",
"alleles": [
"*76"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938803,
"dbSnpId": "rs2031308986",
"call": "A/A",
"alleles": [
"*22"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938828,
"dbSnpId": "rs564813580",
"call": "A/A",
"alleles": [
"*37"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941897,
"dbSnpId": "rs371055887",
"call": "G/G",
"alleles": [
"*20"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941915,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941958,
"dbSnpId": "rs72558187",
"call": "T/T",
"alleles": [
"*13"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941975,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*77"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941976,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*38"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941982,
"dbSnpId": "rs762239445",
"call": "G/G",
"alleles": [
"*39"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942018,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*40"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942205,
"dbSnpId": "rs1304490498",
"call": "CAATGGAAAGA/CAATGGAAAGA",
"alleles": [
"*25"
],
"phased": false,
"wildtypeAllele": "CAATGGAAAGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942216,
"dbSnpId": "rs774607211",
"call": "A/A",
"alleles": [
"*41"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942230,
"dbSnpId": "rs767576260",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942231,
"dbSnpId": "rs12414460",
"call": "G/G",
"alleles": [
"*42"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942233,
"dbSnpId": "rs375805362",
"call": "C/C",
"alleles": [
"*62"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942234,
"dbSnpId": "rs72558189",
"call": "G/G",
"alleles": [
"*14",
"*35"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942243,
"dbSnpId": "rs1375956433",
"call": "T/T",
"alleles": [
"*78"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942249,
"dbSnpId": "rs200965026",
"call": "C/C",
"alleles": [
"*26",
"*44"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942254,
"dbSnpId": "rs199523631",
"call": "C/C",
"alleles": [
"*45"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942255,
"dbSnpId": "rs200183364",
"call": "G/G",
"alleles": [
"*33"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942290,
"dbSnpId": "rs1799853",
"call": "C/C",
"alleles": [
"*2",
"*35",
"*61"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942291,
"dbSnpId": "rs141489852",
"call": "G/G",
"alleles": [
"*63"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942305,
"dbSnpId": "rs754487195",
"call": "G/G",
"alleles": [
"*46"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942306,
"dbSnpId": "rs1289704600",
"call": "C/C",
"alleles": [
"*72"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942308,
"dbSnpId": "rs17847037",
"call": "C/C",
"alleles": [
"*73"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942309,
"dbSnpId": "rs7900194",
"call": "G/G",
"alleles": [
"*8",
"*27"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947782,
"dbSnpId": "rs72558190",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947785,
"dbSnpId": "rs774550549",
"call": "C/C",
"alleles": [
"*47"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947869,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*69"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947907,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*57"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947917,
"dbSnpId": "rs1326630788",
"call": "T/T",
"alleles": [
"*48"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947938,
"dbSnpId": "rs2031531005",
"call": "A/A",
"alleles": [
"*28"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947939,
"dbSnpId": "rs370100007",
"call": "G/G",
"alleles": [
"*74"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949129,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*49"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949144,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*50"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949145,
"dbSnpId": "rs772782449",
"call": "C/C",
"alleles": [
"*82"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949161,
"dbSnpId": null,
"call": "AT/AT",
"alleles": [
"*85"
],
"phased": false,
"wildtypeAllele": "AT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949217,
"dbSnpId": "rs2256871",
"call": "A/A",
"alleles": [
"*9"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949280,
"dbSnpId": "rs9332130",
"call": "A/A",
"alleles": [
"*10",
"*71"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949281,
"dbSnpId": "rs9332131",
"call": "GA/GA",
"alleles": [
"*6"
],
"phased": false,
"wildtypeAllele": "GA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972119,
"dbSnpId": "rs182132442",
"call": "C/C",
"alleles": [
"*29"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972123,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*64"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972134,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*51"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972179,
"dbSnpId": "rs72558192",
"call": "A/A",
"alleles": [
"*16"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972180,
"dbSnpId": "rs988617574",
"call": "C/C",
"alleles": [
"*52"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972183,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*81"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972233,
"dbSnpId": "rs1237225311",
"call": "C/C",
"alleles": [
"*53"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981199,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*65"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981201,
"dbSnpId": "rs57505750",
"call": "T/T",
"alleles": [
"*31"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981224,
"dbSnpId": "rs28371685",
"call": "C/C",
"alleles": [
"*11"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981225,
"dbSnpId": "rs367826293",
"call": "G/G",
"alleles": [
"*34"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981230,
"dbSnpId": "rs1274535931",
"call": "C/C",
"alleles": [
"*58"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981250,
"dbSnpId": "rs750820937",
"call": "C/C",
"alleles": [
"*54"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981258,
"dbSnpId": "rs1297714792",
"call": "C/C",
"alleles": [
"*79"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981281,
"dbSnpId": "rs749060448",
"call": "G/G",
"alleles": [
"*24"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981296,
"dbSnpId": "rs1057910",
"call": "A/A",
"alleles": [
"*3",
"*18",
"*68"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981297,
"dbSnpId": "rs56165452",
"call": "T/T",
"alleles": [
"*4"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981301,
"dbSnpId": "rs28371686",
"call": "C/C",
"alleles": [
"*5"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981302,
"dbSnpId": "rs1250577724",
"call": "C/C",
"alleles": [
"*55"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981305,
"dbSnpId": "rs578144976",
"call": "C/C",
"alleles": [
"*66"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981365,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981371,
"dbSnpId": "rs542577750",
"call": "G/G",
"alleles": [
"*68"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986042,
"dbSnpId": "rs764211126",
"call": "A/A",
"alleles": [
"*56"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986073,
"dbSnpId": "rs72558193",
"call": "A/A",
"alleles": [
"*18"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986136,
"dbSnpId": "rs1254213342",
"call": "A/A",
"alleles": [
"*75"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986174,
"dbSnpId": "rs1441296358",
"call": "G/G",
"alleles": [
"*84"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988852,
"dbSnpId": "rs776908257",
"call": "C/C",
"alleles": [
"*67"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988855,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*59"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988880,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*70"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988917,
"dbSnpId": "rs769942899",
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988925,
"dbSnpId": "rs202201137",
"call": "A/A",
"alleles": [
"*61"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988955,
"dbSnpId": "rs767284820",
"call": "T/T",
"alleles": [
"*60"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988984,
"dbSnpId": "rs781583846",
"call": "G/G",
"alleles": [
"*30"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94989020,
"dbSnpId": "rs9332239",
"call": "C/C",
"alleles": [
"*12",
"*71"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94989023,
"dbSnpId": "rs868182778",
"call": "G/G",
"alleles": [
"*32"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94645745,
"dbSnpId": "rs12777823",
"call": "G/G",
"alleles": [],
"phased": false,
"wildtypeAllele": null,
"hasUndocumentedVariations": false,
"warnings": []
}
],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2D6": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "CYP2D6",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "OUTSIDE",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "pcat-outside-call",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "",
"message": "This comes from an outside data source which does not supply position-level detail. For specific disclaimers and limitations, see the original genotyping source."
}
],
"relatedDrugs": [
{
"name": "amitriptyline",
"id": "PA448385"
},
{
"name": "aripiprazole",
"id": "PA10026"
},
{
"name": "atomoxetine",
"id": "PA134688071"
},
{
"name": "brexpiprazole",
"id": "PA166160053"
},
{
"name": "clomipramine",
"id": "PA449048"
},
{
"name": "codeine",
"id": "PA449088"
},
{
"name": "doxepin",
"id": "PA449409"
},
{
"name": "eliglustat",
"id": "PA166123486"
},
{
"name": "flecainide",
"id": "PA449646"
},
{
"name": "haloperidol",
"id": "PA449841"
},
{
"name": "imipramine",
"id": "PA449969"
},
{
"name": "metoprolol",
"id": "PA450480"
},
{
"name": "nortriptyline",
"id": "PA450657"
},
{
"name": "paroxetine",
"id": "PA450801"
},
{
"name": "pimozide",
"id": "PA450965"
},
{
"name": "propafenone",
"id": "PA451131"
},
{
"name": "risperidone",
"id": "PA451257"
},
{
"name": "tamoxifen",
"id": "PA451581"
},
{
"name": "tramadol",
"id": "PA451735"
},
{
"name": "venlafaxine",
"id": "PA451866"
},
{
"name": "zuclopenthixol",
"id": "PA452629"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP3A4": {
"alleleDefinitionVersion": "2024-03-25-16-13",
"alleleDefinitionSource": "PHARMGKB",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "CYP3A4",
"chr": "chr7",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "CYP3A4",
"version": "2",
"matches": {
"gene": "CYP3A4",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": [
"quetiapine"
]
},
"exception_type": "note",
"message": "The CYP3A4 alleles are determined based on PharmVar CYP3A4 allele definitions. See PharmCAT disclaimer for further information."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP3A4 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "quetiapine",
"id": "PA451201"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A4",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A4",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99758183,
"dbSnpId": "rs67666821",
"call": "G/G",
"alleles": [
"*20"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99758228,
"dbSnpId": "rs1584538410",
"call": "T/T",
"alleles": [
"*46"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99760836,
"dbSnpId": "rs4986913",
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99760901,
"dbSnpId": "rs4986910",
"call": "A/A",
"alleles": [
"*3",
"*37",
"*38"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99760956,
"dbSnpId": "rs774109750",
"call": "T/T",
"alleles": [
"*34"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762047,
"dbSnpId": "rs4986909",
"call": "G/G",
"alleles": [
"*13"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762054,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*45"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762069,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*47"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762177,
"dbSnpId": "rs12721629",
"call": "G/G",
"alleles": [
"*12"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762186,
"dbSnpId": "rs756833413",
"call": "C/C",
"alleles": [
"*33"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762206,
"dbSnpId": "rs67784355",
"call": "G/G",
"alleles": [
"*11",
"*38"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762234,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*48"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99763877,
"dbSnpId": "rs368296206",
"call": "A/A",
"alleles": [
"*32"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99763909,
"dbSnpId": "rs1303250043",
"call": "G/G",
"alleles": [
"*31"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99763925,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*21"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99764003,
"dbSnpId": "rs28371759",
"call": "A/A",
"alleles": [
"*18"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99766411,
"dbSnpId": "rs4646438",
"call": "G/G",
"alleles": [
"*6"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99766424,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*44"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99766439,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99766440,
"dbSnpId": "rs138105638",
"call": "G/G",
"alleles": [
"*26"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768360,
"dbSnpId": "rs55785340",
"call": "A/A",
"alleles": [
"*2"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768371,
"dbSnpId": "rs55901263",
"call": "G/G",
"alleles": [
"*5"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768424,
"dbSnpId": "rs113667357",
"call": "T/T",
"alleles": [
"*24"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768447,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*42"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768458,
"dbSnpId": "rs4987161",
"call": "A/A",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768470,
"dbSnpId": "rs12721627",
"call": "G/G",
"alleles": [
"*16"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768693,
"dbSnpId": "rs35599367",
"call": "G/G",
"alleles": [
"*22",
"*37"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99769769,
"dbSnpId": "rs4986908",
"call": "C/C",
"alleles": [
"*10"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99769781,
"dbSnpId": "rs72552798",
"call": "C/C",
"alleles": [
"*9"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99769804,
"dbSnpId": "rs4986907",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99769805,
"dbSnpId": "rs57409622",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770165,
"dbSnpId": "rs72552799",
"call": "C/C",
"alleles": [
"*8"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770166,
"dbSnpId": "rs778013004",
"call": "G/G",
"alleles": [
"*30"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770196,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*41"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770202,
"dbSnpId": "rs55951658",
"call": "T/T",
"alleles": [
"*4"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770217,
"dbSnpId": "rs1449865051",
"call": "A/A",
"alleles": [
"*29"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99778079,
"dbSnpId": "rs56324128",
"call": "C/C",
"alleles": [
"*7"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99780036,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*40"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99784018,
"dbSnpId": "rs570051168",
"call": "G/G",
"alleles": [
"*28"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99784038,
"dbSnpId": "rs12721634",
"call": "A/A",
"alleles": [
"*14"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99784075,
"dbSnpId": "rs188389063",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99784078,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*39"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP3A5": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "CYP3A5",
"chr": "chr7",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "CYP3A5 reverse complement footnote",
"version": "1",
"matches": {
"gene": "CYP3A5",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The CYP3A5 gene is on the negative chromosomal strand, all genotype calls for CYP3A5 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP3A5 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "tacrolimus",
"id": "PA451578"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99652770,
"dbSnpId": "rs41303343",
"call": "T/T",
"alleles": [
"*7"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99660516,
"dbSnpId": "rs28383479",
"call": "C/C",
"alleles": [
"*9"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99665212,
"dbSnpId": "rs10264272",
"call": "C/C",
"alleles": [
"*6"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99672916,
"dbSnpId": "rs776746",
"call": "T/T",
"alleles": [
"*3"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99676198,
"dbSnpId": "rs55817950",
"call": "G/G",
"alleles": [
"*8"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"DPYD": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "DPYD",
"chr": "chr1",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "DPYD lowest activity score note",
"version": "2",
"matches": {
"gene": "DPYD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": [
"capecitabine",
"fluorouracil",
"tegafur",
"flucytosine"
]
},
"exception_type": "note",
"message": "The two lowest activity values (variant activity scores, see CPIC guideline PMID:29152729) are used for unphased data and the lowest activity value per allele is used for phased data to determine the gene activity score and phenotype to retrieve prescribing recommendations. "
},
{
"rule_name": "DPYD reverse complement footnote",
"version": "1",
"matches": {
"gene": "DPYD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The DPYD gene is on the negative chromosomal strand, all genotype calls for DPYD in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The DPYD Reference allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "capecitabine",
"id": "PA448771"
},
{
"name": "flucytosine",
"id": "PA449654"
},
{
"name": "fluorouracil",
"id": "PA128406956"
},
{
"name": "tegafur",
"id": "PA452620"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"phenotypes": [
"2.0 (Normal Metabolizer)"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0 (Normal Metabolizer)"
],
"label": "Reference/Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": null,
"gene": "DPYD",
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"phenotypes": [
"2.0 (Normal Metabolizer)"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0 (Normal Metabolizer)"
],
"label": "Reference/Reference",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97078987,
"dbSnpId": "rs114096998",
"call": "G/G",
"alleles": [
"c.3067C>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97078993,
"dbSnpId": "rs148799944",
"call": "C/C",
"alleles": [
"c.3061G>C"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079005,
"dbSnpId": "rs140114515",
"call": "C/C",
"alleles": [
"c.3049G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079071,
"dbSnpId": "rs1801268",
"call": "C/C",
"alleles": [
"c.2983G>T (*10)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079076,
"dbSnpId": "rs139459586",
"call": "A/A",
"alleles": [
"c.2978T>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079077,
"dbSnpId": "rs202144771",
"call": "G/G",
"alleles": [
"c.2977C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079121,
"dbSnpId": "rs72547601",
"call": "T/T",
"alleles": [
"c.2933A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079133,
"dbSnpId": "rs72547602",
"call": "T/T",
"alleles": [
"c.2921A>T"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079139,
"dbSnpId": "rs145529148",
"call": "T/T",
"alleles": [
"c.2915A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97082365,
"dbSnpId": "rs141044036",
"call": "T/T",
"alleles": [
"c.2872A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97082391,
"dbSnpId": "rs67376798",
"call": "T/T",
"alleles": [
"c.2846A>T"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098598,
"dbSnpId": "rs1801267",
"call": "C/C",
"alleles": [
"c.2657G>A (*9B)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098599,
"dbSnpId": "rs147545709",
"call": "G/G",
"alleles": [
"c.2656C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098616,
"dbSnpId": "rs55674432",
"call": "C/C",
"alleles": [
"c.2639G>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098632,
"dbSnpId": "rs201035051",
"call": "T/T",
"alleles": [
"c.2623A>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97193109,
"dbSnpId": "rs60139309",
"call": "T/T",
"alleles": [
"c.2582A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97193209,
"dbSnpId": "rs200687447",
"call": "C/C",
"alleles": [
"c.2482G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97234958,
"dbSnpId": "rs199634007",
"call": "G/G",
"alleles": [
"c.2336C>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97234991,
"dbSnpId": "rs56005131",
"call": "G/G",
"alleles": [
"c.2303C>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305279,
"dbSnpId": "rs112766203",
"call": "G/G",
"alleles": [
"c.2279C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305363,
"dbSnpId": "rs60511679",
"call": "A/A",
"alleles": [
"c.2195T>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305364,
"dbSnpId": "rs1801160",
"call": "C/C",
"alleles": [
"c.2194G>A (*6)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305372,
"dbSnpId": "rs146529561",
"call": "G/G",
"alleles": [
"c.2186C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97306195,
"dbSnpId": "rs145548112",
"call": "C/C",
"alleles": [
"c.2161G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97373598,
"dbSnpId": "rs137999090",
"call": "C/C",
"alleles": [
"c.2021G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97373629,
"dbSnpId": "rs138545885",
"call": "C/C",
"alleles": [
"c.1990G>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97382461,
"dbSnpId": "rs55971861",
"call": "T/T",
"alleles": [
"c.1906A>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450058,
"dbSnpId": "rs3918290",
"call": "C/C",
"alleles": [
"c.1905+1G>A (*2A)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450059,
"dbSnpId": "rs3918289",
"call": "G/G",
"alleles": [
"c.1905C>G"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450065,
"dbSnpId": "rs72549303",
"call": "TG/TG",
"alleles": [
"c.1898delC (*3)"
],
"phased": false,
"wildtypeAllele": "TG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450068,
"dbSnpId": "rs17376848",
"call": "A/A",
"alleles": [
"c.1896T>C"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450168,
"dbSnpId": "rs147601618",
"call": "A/A",
"alleles": [
"c.1796T>C"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450187,
"dbSnpId": "rs145773863",
"call": "C/C",
"alleles": [
"c.1777G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450189,
"dbSnpId": "rs138616379",
"call": "C/C",
"alleles": [
"c.1775G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450190,
"dbSnpId": "rs59086055",
"call": "G/G",
"alleles": [
"c.1774C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515784,
"dbSnpId": "rs201615754",
"call": "C/C",
"alleles": [
"c.1682G>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515787,
"dbSnpId": "rs55886062",
"call": "A/A",
"alleles": [
"c.1679T>G (*13)"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515839,
"dbSnpId": "rs1801159",
"call": "T/T",
"alleles": [
"c.1627A>G (*5)"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515851,
"dbSnpId": "rs142619737",
"call": "C/C",
"alleles": [
"c.1615G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515865,
"dbSnpId": "rs1801158",
"call": "C/C",
"alleles": [
"c.1601G>A (*4)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515889,
"dbSnpId": "rs190951787",
"call": "G/G",
"alleles": [
"c.1577C>G"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515923,
"dbSnpId": "rs148994843",
"call": "C/C",
"alleles": [
"c.1543G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549565,
"dbSnpId": "rs138391898",
"call": "C/C",
"alleles": [
"c.1519G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549600,
"dbSnpId": "rs111858276",
"call": "T/T",
"alleles": [
"c.1484A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549609,
"dbSnpId": "rs72549304",
"call": "G/G",
"alleles": [
"c.1475C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549681,
"dbSnpId": "rs199549923",
"call": "G/G",
"alleles": [
"c.1403C>A"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549713,
"dbSnpId": "rs57918000",
"call": "G/G",
"alleles": [
"c.1371C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549726,
"dbSnpId": "rs144395748",
"call": "G/G",
"alleles": [
"c.1358C>G"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549735,
"dbSnpId": "rs72975710",
"call": "G/G",
"alleles": [
"c.1349C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573785,
"dbSnpId": "rs186169810",
"call": "A/A",
"alleles": [
"c.1314T>G"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573805,
"dbSnpId": "rs142512579",
"call": "C/C",
"alleles": [
"c.1294G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573821,
"dbSnpId": "rs764666241",
"call": "C/C",
"alleles": [
"c.1278G>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573839,
"dbSnpId": "rs200064537",
"call": "A/A",
"alleles": [
"c.1260T>A"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573863,
"dbSnpId": "rs56038477",
"call": "C/C",
"alleles": [
"c.1129-5923C>G, c.1236G>A (HapB3)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573881,
"dbSnpId": "rs61622928",
"call": "C/C",
"alleles": [
"c.1218G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573918,
"dbSnpId": "rs143815742",
"call": "C/C",
"alleles": [
"c.1181G>T"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573919,
"dbSnpId": "rs140602333",
"call": "G/G",
"alleles": [
"c.1180C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573943,
"dbSnpId": "rs78060119",
"call": "C/C",
"alleles": [
"c.1156G>T (*12)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97579893,
"dbSnpId": "rs75017182",
"call": "G/G",
"alleles": [
"c.1129-5923C>G",
"c.1129-5923C>G, c.1236G>A (HapB3)"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593238,
"dbSnpId": "rs72549305",
"call": "T/T",
"alleles": [
"c.1108A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593289,
"dbSnpId": "rs143154602",
"call": "G/G",
"alleles": [
"c.1057C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593322,
"dbSnpId": "rs183385770",
"call": "C/C",
"alleles": [
"c.1024G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593343,
"dbSnpId": "rs72549306",
"call": "C/C",
"alleles": [
"c.1003G>T (*11)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593379,
"dbSnpId": "rs201018345",
"call": "C/C",
"alleles": [
"c.967G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97595083,
"dbSnpId": "rs145112791",
"call": "G/G",
"alleles": [
"c.934C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97595088,
"dbSnpId": "rs150437414",
"call": "A/A",
"alleles": [
"c.929T>C"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97595149,
"dbSnpId": "rs146356975",
"call": "T/T",
"alleles": [
"c.868A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97679170,
"dbSnpId": "rs45589337",
"call": "T/T",
"alleles": [
"c.775A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97691776,
"dbSnpId": "rs1801266",
"call": "G/G",
"alleles": [
"c.703C>T (*8)"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699399,
"dbSnpId": "rs72549307",
"call": "T/T",
"alleles": [
"c.632A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699430,
"dbSnpId": "rs72549308",
"call": "T/T",
"alleles": [
"c.601A>C"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699474,
"dbSnpId": "rs115232898",
"call": "T/T",
"alleles": [
"c.557A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699506,
"dbSnpId": "rs6670886",
"call": "C/C",
"alleles": [
"c.525G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699533,
"dbSnpId": "rs139834141",
"call": "C/C",
"alleles": [
"c.498G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699535,
"dbSnpId": "rs2297595",
"call": "T/T",
"alleles": [
"c.496A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97721542,
"dbSnpId": "rs200562975",
"call": "T/T",
"alleles": [
"c.451A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97721650,
"dbSnpId": "rs141462178",
"call": "T/T",
"alleles": [
"c.343A>G"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97740400,
"dbSnpId": "rs150385342",
"call": "C/C",
"alleles": [
"c.313G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97740410,
"dbSnpId": "rs72549309",
"call": "GATGA/GATGA",
"alleles": [
"c.295_298delTCAT (*7)"
],
"phased": false,
"wildtypeAllele": "GATGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883329,
"dbSnpId": "rs1801265",
"call": "A/A",
"alleles": [
"c.85T>C (*9A)"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883352,
"dbSnpId": "rs80081766",
"call": "C/C",
"alleles": [
"c.62G>A"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883353,
"dbSnpId": "rs72549310",
"call": "G/G",
"alleles": [
"c.61C>T"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883368,
"dbSnpId": "rs150036960",
"call": "G/G",
"alleles": [
"c.46C>G"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"HLA-A": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": null,
"phenotypeSource": "DPWG",
"geneSymbol": "HLA-A",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "NONE",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "carbamazepine",
"id": "PA448785"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-A",
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-A",
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"HLA-B": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": null,
"phenotypeSource": "DPWG",
"geneSymbol": "HLA-B",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "OUTSIDE",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "pcat-outside-call",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "",
"message": "This comes from an outside data source which does not supply position-level detail. For specific disclaimers and limitations, see the original genotyping source."
}
],
"relatedDrugs": [
{
"name": "abacavir",
"id": "PA448004"
},
{
"name": "allopurinol",
"id": "PA448320"
},
{
"name": "carbamazepine",
"id": "PA448785"
},
{
"name": "flucloxacillin",
"id": "PA164781042"
},
{
"name": "lamotrigine",
"id": "PA450164"
},
{
"name": "oxcarbazepine",
"id": "PA450732"
},
{
"name": "phenytoin",
"id": "PA450947"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"MT-RNR1": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": null,
"phenotypeSource": "DPWG",
"geneSymbol": "MT-RNR1",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "OUTSIDE",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "pcat-outside-call",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "",
"message": "This comes from an outside data source which does not supply position-level detail. For specific disclaimers and limitations, see the original genotyping source."
}
],
"relatedDrugs": [],
"sourceDiplotypes": [
{
"allele1": {
"gene": "MT-RNR1",
"name": "1555A>G",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": null,
"gene": "MT-RNR1",
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [],
"label": "1555A>G",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "MT-RNR1",
"name": "1555A>G",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": null,
"gene": "MT-RNR1",
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [],
"label": "1555A>G",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"NUDT15": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "NUDT15",
"chr": "chr13",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The NUDT15 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "azathioprine",
"id": "PA448515"
},
{
"name": "mercaptopurine",
"id": "PA450379"
},
{
"name": "thioguanine",
"id": "PA451663"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037748,
"dbSnpId": "rs769369441",
"call": "T/T",
"alleles": [
"*10"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037749,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037782,
"dbSnpId": "rs746071566",
"call": "AGGAGTC/AGGAGTC",
"alleles": [
"*2",
"*6",
"*9"
],
"phased": false,
"wildtypeAllele": "AGGAGTC",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037798,
"dbSnpId": "rs186364861",
"call": "G/G",
"alleles": [
"*5"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037825,
"dbSnpId": "rs777311140",
"call": "C/C",
"alleles": [
"*14"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037834,
"dbSnpId": "rs1202487323",
"call": "C/C",
"alleles": [
"*16"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037847,
"dbSnpId": "rs766023281",
"call": "G/G",
"alleles": [
"*7"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037849,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*8"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037885,
"dbSnpId": "rs1950545307",
"call": "G/G",
"alleles": [
"*11"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037902,
"dbSnpId": "rs149436418",
"call": "C/C",
"alleles": [
"*12"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48040977,
"dbSnpId": "rs1457579126",
"call": "GA/GA",
"alleles": [
"*18"
],
"phased": false,
"wildtypeAllele": "GA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48041103,
"dbSnpId": "rs761191455",
"call": "T/T",
"alleles": [
"*13"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48041113,
"dbSnpId": "rs1368252918",
"call": "G/G",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045690,
"dbSnpId": "rs768324690",
"call": "C/C",
"alleles": [
"*20"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045719,
"dbSnpId": "rs116855232",
"call": "C/C",
"alleles": [
"*2",
"*3"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045720,
"dbSnpId": "rs147390019",
"call": "G/G",
"alleles": [
"*4"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045771,
"dbSnpId": "rs139551410",
"call": "T/T",
"alleles": [
"*15"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"SLCO1B1": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "SLCO1B1",
"chr": "chr12",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The SLCO1B1 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "atorvastatin",
"id": "PA448500"
},
{
"name": "simvastatin",
"id": "PA451363"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172734,
"dbSnpId": "rs139257324",
"call": "C/C",
"alleles": [
"*33"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172776,
"dbSnpId": "rs373327528",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172782,
"dbSnpId": "rs56101265",
"call": "T/T",
"alleles": [
"*2",
"*12"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21174595,
"dbSnpId": "rs56061388",
"call": "T/T",
"alleles": [
"*3",
"*13"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176804,
"dbSnpId": "rs2306283",
"call": "A/A",
"alleles": [
"*14",
"*15",
"*20",
"*24",
"*25",
"*27",
"*28",
"*29",
"*30",
"*31",
"*32",
"*33",
"*37",
"*39",
"*42",
"*43",
"*44",
"*46",
"*47"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176868,
"dbSnpId": "rs2306282",
"call": "A/A",
"alleles": [
"*16"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176871,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*38"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176879,
"dbSnpId": "rs11045819",
"call": "C/C",
"alleles": [
"*4",
"*14",
"*25",
"*32",
"*43"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176883,
"dbSnpId": "rs72559745",
"call": "A/A",
"alleles": [
"*3",
"*13"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176898,
"dbSnpId": "rs77271279",
"call": "G/G",
"alleles": [
"*41"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178612,
"dbSnpId": "rs141467543",
"call": "A/A",
"alleles": [
"*42"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178615,
"dbSnpId": "rs4149056",
"call": "T/T",
"alleles": [
"*5",
"*15",
"*40",
"*46",
"*47"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178957,
"dbSnpId": "rs79135870",
"call": "A/A",
"alleles": [
"*30"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21196951,
"dbSnpId": "rs11045852",
"call": "A/A",
"alleles": [
"*24",
"*25",
"*28",
"*32",
"*33",
"*43",
"*44"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21196975,
"dbSnpId": "rs183501729",
"call": "C/C",
"alleles": [
"*39"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21196976,
"dbSnpId": "rs11045853",
"call": "G/G",
"alleles": [
"*25",
"*28",
"*33"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21200544,
"dbSnpId": "rs72559747",
"call": "C/C",
"alleles": [
"*47"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21200595,
"dbSnpId": "rs55901008",
"call": "T/T",
"alleles": [
"*6"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202553,
"dbSnpId": "rs1228465562",
"call": "T/T",
"alleles": [
"*36"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202555,
"dbSnpId": "rs59113707",
"call": "C/C",
"alleles": [
"*27"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202649,
"dbSnpId": "rs56387224",
"call": "A/A",
"alleles": [
"*7"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202664,
"dbSnpId": "rs142965323",
"call": "G/G",
"alleles": [
"*26"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21205921,
"dbSnpId": "rs72559748",
"call": "A/A",
"alleles": [
"*8"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21205999,
"dbSnpId": "rs59502379",
"call": "G/G",
"alleles": [
"*9",
"*31"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21206031,
"dbSnpId": "rs74064213",
"call": "A/A",
"alleles": [
"*43",
"*44"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21222355,
"dbSnpId": "rs71581941",
"call": "C/C",
"alleles": [
"*45",
"*46"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239042,
"dbSnpId": "rs34671512",
"call": "A/A",
"alleles": [
"*19",
"*20",
"*40"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239077,
"dbSnpId": "rs56199088",
"call": "A/A",
"alleles": [
"*10",
"*12"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239113,
"dbSnpId": "rs55737008",
"call": "A/A",
"alleles": [
"*11",
"*13"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239145,
"dbSnpId": "rs200995543",
"call": "C/C",
"alleles": [
"*34"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239158,
"dbSnpId": "rs140790673",
"call": "C/C",
"alleles": [
"*29"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"TPMT": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "TPMT",
"chr": "chr6",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "TPMT reverse complement footnote",
"version": "1",
"matches": {
"gene": "TPMT",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The TPMT gene is on the negative chromosomal strand, all genotype calls for TPMT in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The TPMT *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "azathioprine",
"id": "PA448515"
},
{
"name": "mercaptopurine",
"id": "PA450379"
},
{
"name": "thioguanine",
"id": "PA451663"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130687,
"dbSnpId": "rs1142345",
"call": "T/T",
"alleles": [
"*3A",
"*3C",
"*41"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130694,
"dbSnpId": "rs150900439",
"call": "T/T",
"alleles": [
"*20"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130725,
"dbSnpId": "rs72552736",
"call": "A/A",
"alleles": [
"*7"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130729,
"dbSnpId": "rs139392616",
"call": "C/C",
"alleles": [
"*40"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130758,
"dbSnpId": "rs398122996",
"call": "A/A",
"alleles": [
"*37"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130762,
"dbSnpId": "rs56161402",
"call": "C/C",
"alleles": [
"*8"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130772,
"dbSnpId": "rs377085266",
"call": "A/A",
"alleles": [
"*25"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130781,
"dbSnpId": "rs1800584",
"call": "C/C",
"alleles": [
"*4"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18132136,
"dbSnpId": "rs72556347",
"call": "A/A",
"alleles": [
"*26"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18132147,
"dbSnpId": "rs79901429",
"call": "A/A",
"alleles": [
"*31"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18132163,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*36"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133845,
"dbSnpId": "rs75543815",
"call": "T/T",
"alleles": [
"*6"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133847,
"dbSnpId": "rs6921269",
"call": "C/C",
"alleles": [
"*24"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133870,
"dbSnpId": "rs772832951",
"call": "A/A",
"alleles": [
"*38"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133884,
"dbSnpId": "rs74423290",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133887,
"dbSnpId": "rs201695576",
"call": "T/T",
"alleles": [
"*44"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133890,
"dbSnpId": "rs9333570",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18138969,
"dbSnpId": "rs144041067",
"call": "C/C",
"alleles": [
"*16",
"*22"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18138970,
"dbSnpId": "rs112339338",
"call": "G/G",
"alleles": [
"*33"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18138997,
"dbSnpId": "rs1800460",
"call": "C/C",
"alleles": [
"*3A",
"*3B"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18139027,
"dbSnpId": "rs72552737",
"call": "C/C",
"alleles": [
"*10"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18139689,
"dbSnpId": "rs72552738",
"call": "C/C",
"alleles": [
"*11"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18139710,
"dbSnpId": "rs200220210",
"call": "G/G",
"alleles": [
"*12"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143597,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*19"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143606,
"dbSnpId": "rs151149760",
"call": "T/T",
"alleles": [
"*9"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143613,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*28"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143622,
"dbSnpId": "rs115106679",
"call": "C/C",
"alleles": [
"*32"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143643,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*27"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143700,
"dbSnpId": "rs753545734",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143718,
"dbSnpId": "rs111901354",
"call": "G/G",
"alleles": [
"*34"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143724,
"dbSnpId": "rs1800462",
"call": "C/C",
"alleles": [
"*2"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143728,
"dbSnpId": "rs1256618794",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147838,
"dbSnpId": "rs281874771",
"call": "G/G",
"alleles": [
"*39"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147845,
"dbSnpId": "rs777686348",
"call": "C/C",
"alleles": [
"*18"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147851,
"dbSnpId": "rs200591577",
"call": "G/G",
"alleles": [
"*21"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147856,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*35"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147910,
"dbSnpId": "rs72552740",
"call": "A/A",
"alleles": [
"*5"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149004,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*17"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149022,
"dbSnpId": "rs750424422",
"call": "C/C",
"alleles": [
"*30"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149032,
"dbSnpId": "rs759836180",
"call": "C/C",
"alleles": [
"*42"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149045,
"dbSnpId": "rs72552742",
"call": "T/T",
"alleles": [
"*13"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149126,
"dbSnpId": "rs267607275",
"call": "A/A",
"alleles": [
"*29"
],
"phased": false,
"wildtypeAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149127,
"dbSnpId": "rs9333569",
"call": "T/T",
"alleles": [
"*14"
],
"phased": false,
"wildtypeAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"UGT1A1": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "UGT1A1",
"chr": "chr2",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "UGT1A1 repeat warning",
"version": "1",
"matches": {
"gene": "UGT1A1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "Some alleles in UGT1A1 are distinguished by a repeat sequence; some genotyping technologies may not accurately call the repeat."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The UGT1A1 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "irinotecan",
"id": "PA450085"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233759924,
"dbSnpId": "rs887829",
"call": "C/C",
"alleles": [
"*80",
"*80+*28",
"*80+*37"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233760233,
"dbSnpId": "rs3064744",
"call": "CAT/CAT",
"alleles": [
"*28",
"*36",
"*37",
"*80+*28",
"*80+*37"
],
"phased": false,
"wildtypeAllele": "CAT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233760498,
"dbSnpId": "rs4148323",
"call": "G/G",
"alleles": [
"*6"
],
"phased": false,
"wildtypeAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233760973,
"dbSnpId": "rs35350960",
"call": "C/C",
"alleles": [
"*27"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"VKORC1": {
"alleleDefinitionVersion": "v1.38.0-1-g39f50e7",
"alleleDefinitionSource": "CPIC",
"phenotypeVersion": "2024-03-25-16-13",
"phenotypeSource": "DPWG",
"geneSymbol": "VKORC1",
"chr": "chr16",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "VKORC1 reverse complement footnote",
"version": "1",
"matches": {
"gene": "VKORC1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": null,
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The VKORC1 gene is on the negative chromosomal strand, all genotype calls for VKORC1 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
}
],
"relatedDrugs": [
{
"name": "acenocoumarol",
"id": "PA452632"
},
{
"name": "phenprocoumon",
"id": "PA450921"
},
{
"name": "warfarin",
"id": "PA451906"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"combination": false,
"phenotypeDataSource": "DPWG"
}
],
"variants": [
{
"gene": "VKORC1",
"chromosome": "chr16",
"position": 31096368,
"dbSnpId": "rs9923231",
"call": "C/C",
"alleles": [
"rs9923231 variant (T)"
],
"phased": false,
"wildtypeAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
}
}
},
"drugs": {
"CPIC": {
"abacavir": {
"name": "abacavir",
"id": "PA448004",
"source": "CPIC",
"version": "2024-03-25-16-13",
"messages": [],
"variants": [],
"urls": [
"https://www.pharmgkb.org/guidelineAnnotation/PA166104997"
],
"citations": [
{
"pmid": "22378157",
"title": "Clinical pharmacogenetics implementation consortium guidelines for HLA-B genotype and abacavir dosing.",
"authors": [
"Martin M A",
"Klein T E",
"Dong B J",
"Pirmohamed M",
"Haas D W",
"Kroetz D L",
"Clinical Pharmacogenetics Implementation Consortium"
],
"journal": "Clinical pharmacology and therapeutics",
"year": 2012
},
{
"pmid": "24561393",
"title": "Clinical Pharmacogenetics Implementation Consortium Guidelines for HLA-B Genotype and Abacavir Dosing: 2014 update.",
"authors": [
"Martin M A",
"Hoffman J M",
"Freimuth R R",
"Klein T E",
"Dong B J",
"Pirmohamed M",
"Hicks J K",
"Wilkinson M R",
"Haas D W",
"Kroetz D L",
"Clinical Pharmacogenetics Implementation Consortium"
],
"journal": "Clinical pharmacology and therapeutics",
"year": 2014
}
],
"guidelines": [
{
"id": "PA166104997",
"name": "Annotation of CPIC Guideline for abacavir and HLA-B",
"source": "CPIC",
"version": "2024-03-25-16-13",
"url": "https://www.pharmgkb.org/guidelineAnnotation/PA166104997",
"annotations": [
{
"implications": [
"HLA-B: Significantly increased risk of abacavir hypersensitivity"
],
"drugRecommendation": "Abacavir is not recommended",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*58:01 negative"
},
"lookupKey": {
"HLA-B": "*57:01 positive"
}
}
]
}
]
},
"allopurinol": {
"name": "allopurinol",
"id": "PA448320",
"source": "CPIC",
"version": "2024-03-25-16-13",
"messages": [],
"variants": [],
"urls": [
"https://www.pharmgkb.org/guidelineAnnotation/PA166105003"
],
"citations": [
{
"pmid": "23232549",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for human leukocyte antigen-B genotype and allopurinol dosing.",
"authors": [
"Hershfield M S",
"Callaghan J T",
"Tassaneeyakul W",
"Mushiroda T",
"Thorn C F",
"Klein T E",
"Lee M T M"
],
"journal": "Clinical pharmacology and therapeutics",
"year": 2013
},
{
"pmid": "26094938",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for human leukocyte antigen B (HLA-B) genotype and allopurinol dosing: 2015 update.",
"authors": [
"Saito Y",
"Stamp L K",
"Caudle K E",
"Hershfield M S",
"McDonagh E M",
"Callaghan J T",
"Tassaneeyakul W",
"Mushiroda T",
"Kamatani N",
"Goldspiel B R",
"Phillips E J",
"Klein T E",
"Lee M T M",
"Clinical Pharmacogenetics Implementation Consortium"
],
"journal": "Clinical pharmacology and therapeutics",
"year": 2016
}
],
"guidelines": [
{
"id": "PA166105003",
"name": "Annotation of CPIC Guideline for allopurinol and HLA-B",
"source": "CPIC",
"version": "2024-03-25-16-13",
"url": "https://www.pharmgkb.org/guidelineAnnotation/PA166105003",
"annotations": [
{
"implications": [
"HLA-B: Low or reduced risk of allopurinol-induced SCAR"
],
"drugRecommendation": "Use allopurinol per standard dosing guidelines",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"combination": false,
"phenotypeDataSource": "CPIC"
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*58:01 negative"
},
"lookupKey": {
"HLA-B": "*58:01 negative"
}
}
]
}
]
},
"amikacin": {
"name": "amikacin",
"id": "PA164744372",
"source": "CPIC",
"version": "2024-03-25-16-13",
"messages": [],
"variants": [],
"urls": [
"https://www.pharmgkb.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"authors": [
"McDermott John Henry",
"Wolf Joshua",
"Hoshitsuki Keito",
"Huddart Rachel",
"Caudle Kelly E",
"Whirl-Carrillo Michelle",
"Steyger Peter S",
"Smith Richard J H",
"Cody Neal",
"Rodriguez-Antona Cristina",
"Klein Teri E",
"Newman William G"
],
"journal": "Clinical pharmacology and therapeutics",
"year": 2022
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, gentamicin, kanamycin, paromomycin, plazomicin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC",
"version": "2024-03-25-16-13",
"url": "https://www.pharmgkb.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"amitriptyline": {
"name": "amitriptyline",
"id": "PA448385",
"source": "CPIC",
"version": "2024-03-25-16-13",
"messages": [],
"variants": [],
"urls": [
"https://www.pharmgkb.org/guidelineAnnotation/PA166105006"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"authors": [
"Hicks J K",
"Swen J J",
"Thorn C F",
"Sangkuhl K",
"Kharasch E D",
"Ellingrod V L",
"Skaar T C",
"MĂ¼ller D J",
"Gaedigk A",
"Stingl J C",
"Clinical Pharmacogenetics Implementation Consortium"
],
"journal": "Clinical pharmacology and therapeutics",
"year": 2013
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"authors": [
"Hicks J K",
"Sangkuhl K",
"Swen J J",
"Ellingrod V L",
"MĂ¼ller D J",
"Shimoda K",
"Bishop J R",
"Kharasch E D",
"Skaar T C",
"Gaedigk A",
"Dunnenberger H M",
"Klein T E",
"Caudle K E",
"Stingl J C"
],
"journal": "Clinical pharmacology and therapeutics",
"year": 2017
}
],
"guidelines": [
{
"id": "PA166105006",
"name": "Annotation of CPIC Guideline for amitriptyline and CYP2C19, CYP2D6",
"source": "CPIC",
"version": "2024-03-25-16-13",
"url": "https://www.pharmgkb.org/guidelineAnnotation/PA166105006",
"annotations": [
{
"implications": [
"CYP2C19: Normal metabolism of tertiary amines",
"CYP2D6: Reduced metabolism of TCAs to less active compounds compared to normal metabolizers; Higher plasma concentrations of active drug will increase the probability of side effects"
],
"drugRecommendation": "Consider a 25% reduction of recommended starting dose. Utilize therapeutic drug monitoring to guide dose adjustments.\n